Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig2083
Contig Information
Length 885 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 5 Clones [Download: CSV  ,  FASTA ]
whgc6a17    rwhgc2e16    rwhgc4c03    rwhgc6a17    rwhgc15b23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit tubulin alpha-3 chain [Zea mays]
Score 1187
Evalue 2.69949e-128
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig2083
AGCAGGGTTCATACAACACAACAGGGGTTGTAAACCAAACACCACACAGCAAACATTCAATTCAAACAGACAGAAAACAGATAAAGCCACTCGGGCAGAT
CATCAGGTCGCAATCTCAGCTGCTCTAGTACTCATCACCCTCATCACCATCCTCACCCTCGTCGAACTCAGCACCAACTTCTTCATAGTCCTTCTCCAGG
GCAGCGAGATCCTCACGGGCCTCAGAGAACTCTCCCTCCTCCATGCCCTCACCCACGTACCAGTGGACGAAGGCACGCTTGGCGTACATCAGGTCGAACT
TGTGGTCGATGCGGGAGAAGACCTCGACAACGCTGGTGGAGTTGGAGATCATGCAGACGGCCCTCTGGACCTTGGCAAGGTCGCCGCCTGGGACAACGCT
GGGTGGCTGGTAGTTGATACCACACTTGAAACCAGTGGGGCACCAGTCCACAAACTGGATGGTGCGCTTCGTCTTGATGGTGGCCACAGCGGCGTTGACA
TCCTTGGGCACAACATCACCACGGTACATGAGGCAGCAGGCCATGTACTTGCCGTGGCGGGGGTCACACTTGGCCATCATGGAGGAAGGCTCGAAGGCGC
TGTTGGTGATCTCGGCAACAGAGAGCTGCTCATGGTAAGCCTTCTCGGCTGAGATCACTGGGGCGTAGGAGGAAAGCATGAAGTGGATTCTTGGGTAGGG
CACCAGGTTGGTCTGGAACTCGTTGACATCAACATTCAGAGCACCATCAAACCTCAGGGAAGCAGTCAGGGATGAGATGACCTGAGAAACGAGCCTGTTG
AGGTTGGTGTATGTTGGGCGCTCAATGTCAAGGGAGCGGCGGCAGATGTCATAGATGGCCTCATGTCAAGGAGGACAGCCACATC
page-top