Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig2062
Contig Information
Length 293 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 5 Clones [Download: CSV  ,  FASTA ]
whgc10b02    whgc10b13    whgc10b14    rwhgc10b02    rwhgc10b13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein BRAFLDRAFT_133850 [Branchiostoma floridae] >gi|210091621|gb|EEA39868.1| hypothetical protein BRAFLDRAFT_133850 [Branchiostoma floridae]
Score 65
Evalue 0.781671
Total Hit Count 5
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig2062
GCGGAGCGAGCTGGATGCAATGCATCCTTGCTAATAACTAGTAGGTCCTATTTATCCAGACCTGATTCTTGTTGCTGACACCAACCCAACCCCCACCCCA
TCCCATTCATGTGTATATTTTCATGGAGCCGAGCATTGGTGGTCAGCAGCAGGAGGATCTGCTTGCTTAATTTTAATTTTAGTTTTAATTACTGCCGCAT
CGATTGTAGCGCGTTGTTTGTTTGTTTGTTTGTTTGTTTGTTTGTTTGGATGGTGAATGAATGAATGAATGAATTTCCTCCTTAAAAAAAAAA
page-top