Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig1710
Contig Information
Length 608 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 12 Clones [Download: CSV  ,  FASTA ]
whfl32l21    whfl42c14    whfl52f12    whfl9d16    whfl48h18    whfl51m22    whfl28d11    whfl15k16    whfl7k19    whfl10b09    whfl12k13    whfl9a04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_02947 [Oryza sativa Indica Group]
Score 928
Evalue 8.77164e-100
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig1710
aagAGTTCCGCAGAGGCAGAGTTTTTTACGGAGTACGGCGACGCAAGTCGATACAAGATTCAGGAAATCGTTGGAAAGGGCAGCTACGGTGTCGTGTGCT
CCGCAATAGATGTCCACACCGGAGAGAAAGTGGCGATAAAAAAGATACATGATATCTTTGAGCACATATCTGATGCTGCACGGATTCTCCGTGAGATCAA
GCTTCTGAGGCTCTTAAGACATCCTGACATTGTTGAGATCAAGCATATTATGTTACCTCCATCGAGACGAGACTTCAAAGATATTTATGTCGTTTTTGAG
CTCATGGAGTCTGATCTCCACCAGGTTATAAAGGCTAATGATGACTTGACAAAGGAGCATTACCAATTCTTTCTTTACCAATTACTCCGGGCTCTGAAGT
ACATTCACACTGCTAATGTTTATCACCGGGACCTAAAGCCAAAGAATATATTGGCAAATTCCAACTGCAAACTGAAGATTTGTGATTTTGGATTGGCACG
AGTTGCATTCAACGATACCCCTACAACAATCTTTTGGACGGATTATGTTGCGACAAGATGGTATAGAGCTCCAGAAGCTCTGTGGTTCCTTcttttcaaa
gtatacac
page-top