Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig1996
Contig Information
Length 494 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 4 Clones [Download: CSV  ,  FASTA ]
whgc5f03    whgc5f11    rwhgc5f03    rwhgc5f11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative rubisco small subunit [Triticum turgidum subsp. durum]
Score 674
Evalue 2.16347e-69
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig1996
CCTCGTGCCGGGCCGATTGAGGGCATCAAGAAGTTCGAGACCCTGTCTTACTTGCCACCCCTCTCCACGGAGGCCCTCCTGAAGCAGGTCGACTACTTGA
TCCGCTCCAAGTGGGTGCCCTGCCTCGAGTTCAGCAAGGTTGGCTTCGTTTTCCGTGAGCACAACAGCTCCCCCGGGTACTACGATGGTCGATACTGGAC
AATGTGGAAGCTGCCTATGTTCGGGTGCACCGACGCCACACAGGTGCTCAACGAGGTGGAGGAGGTCAAGAAGGAGTACCCTGACGCCTATGTCCGCGTC
ATCGGCTTCGACAACCTGCGCCAGGTGCAGTGCGTCAGCTTCATCGCCTTCAGGCCACCGGGTTGCGAGGAGTCTGGCAAGGCCTAAACTACGAGTTGAA
ACAATGGCCTATGTATGAAGGTCTTTTGTGAACTTAACTTTTGTCCACCACTCTGCTGGACGACCAGAGCATATTTTTCATTCTAAAAAAAAAA
page-top