Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig17
Contig Information
Length 874 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl1k17    rwhfl1k17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_26812 [Oryza sativa Indica Group]
Score 408
Evalue 5.66595e-38
Total Hit Count 28
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig17
acattcgaggttcaggaccggccagagtggagcaatgaaggccgtcgccggccaccagtaccacggcgtccacccaccgtcgccgacgccggcgactaag
atctccattcctgtctccgCCGGCGGGGGCGCGGAGGCGGCGCTGCTCGGGAAGGGGCGGTACAAGGCATGGACCCTCGCCGCCATCGCCCTCCTCGCGc
tctgGTCCATGTTCGCCGCCTCCGTCACCCTCCGCTGGTCCTCCGGCGACCTTGCCGCCGCCCCCTGGGACTTGAGTAGTCCCCTCCTCGACGACCTCGA
CCCGCTCGAGATGGAGGAAAGGGAGAAACTAGTGCGCCGGATGTGGGACTTGTACACGCGCACTGGTGATCATGTATGGCTTCCGCGGTTCTGGCAAGAA
GCATTTGAGGCTGCATATGAGGAGCTTGCTGGTGAtgataCGCCTGCAAGTGACGCAGCTGTATCGGAGATTGCTCGCATGGCAATTCAcagggcCTGAG
CTTgagcaggcaggtaataataattagaaacagtacactgtgaccatttggagaagtggaggcccaagcctccagggtgaatgagtagatggttcatgca
aaatttgtctgtcccatttcaagagaagattttttacaaagatcatttcaagagaagatcacttgctaactgtgatcatcgcatcatttcaacttctctc
cgtagtctttcatctctttgtgcagtatgtgaagttaacttgcaccttcatgaagcggactgatcctcatctccctcgtaagaagtactttggaattctt
agtaaccagatgagaatatctctagttatgtatgttctgcacatatcgagaaggaacatcgctgcgaaaaaatg
page-top