Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig1933
Contig Information
Length 1196 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 4 Clones [Download: CSV  ,  FASTA ]
whgc10a09    whgc8k06    rwhgc7g18    rwhgc8k06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os08g0113100 [Oryza sativa (japonica cultivar-group)] >gi|122234591|sp|Q0J8G4|SCRK2_ORYSJ RecName: Full=Fructokinase-2; AltName: Full=Fructokinase II; AltName: Full=OsFKII >gi|158513662|sp|A2YQL4|SCRK2_ORYSI RecName: Full=Fructokinase-2; AltName: Full=Fructokinase II; AltName: Full=OsFKII >gi|16566704|gb|AAL26573.1|AF429947_1 putative fructokinase II [Oryza sativa] >gi|32352126|dbj|BAC78556.1| fructokinase [Oryza sativa Japonica Group] >gi|42408363|dbj|BAD09515.1| putative fructokinase [Oryza sativa Japonica Group] >gi|113622806|dbj|BAF22751.1| Os08g0113100 [Oryza sativa (japonica cultivar-group)] >gi|125601970|gb|EAZ41295.1| hypothetical protein OsJ_024778 [Oryza sativa (japonica cultivar-group)] >gi|215687214|dbj|BAG91779.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215708813|dbj|BAG94082.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1536
Evalue 1.47468e-168
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig1933
GGCTCGATCTATTTCTTCCGCACCGTTTCAATGGCGCCTCTTGGTGATACTGTTGCTTCTGTGGCCTCGGCGGCGGCGCCCGGCCTCGTCGTCTCCTTCG
GTGAGATGCTGATCGACTTCGTGCCGGACGTGGCCGGCGTCTCGCTCGCTGAGTCCGGAGGCTTCGTCAAGGCGCCTGGGGGTGCACCTGCCAACGTCGC
ATGCGCCATCTCCAAGCTCGGCGGCTCCTCCGCCTTCGTTGGCAAGTTTGGCGACGACGAGTTCGGCCACATGCTGGTGGACATCCTCAAGCAGAACGGC
GTGAACGCGGAGGGCTGCCTCTTCGACCAGCACGCGCGCACCGCCCTGGCCTTCGTCACCCTCAAGTCCAACGGAGAGCGTGAGTTCATGTTCTACCGCA
ACCCATCCGCCGACATGCTCCTCACCGAGGCGGAGCTCAACCTCGACCTCATCCGCCGCGCCCGCATCTTCCACTATGGCTCCATCTCGCTCATCACCGA
GCCCTGCCGCTCCGCCCACGTGGCCGCCATGCGCGCCGCGAAGTCCGCTGGCATCCTCTGCTCCTACGATCCCAACGTGCGCCTCCCGCTTTGGCCCTCC
GCGCAAGCCGCACGTGATGGCATCATGAGCATCTGGAAGGAGGCCGACTTCATCAAGGTGAGCGACGAGGAGGTGGCCTTCCTCACCCAAGGCGACGCCC
ATGACGAGAAGAACGTCCTCTCCCTCTGGTTCGAGGGCCTCAAGCTGCTCGTCGTCACAGACGGCGAGAAGGGGTGCAGGTACTTCACCAAGGACTTCAA
GGGCTCCCTGCCAGGGTACACCGTCAACACGGTCGACACCACTGGCGCCGGCGATGCCTTTGTTGGATCCCTCCTCCTCAACGTCGCCAAGGACGACTCC
ATCTTCTATAACGAGGCCAAGCTGAGGGAGGTGCTGCAGTTCTCAAACGCTTGCGGGGCCATTTGCACCACCAAGAAGGGAGCCATCCCGGCGTTGCCCA
CCACCGCCACCGCCCTGGAGCTCATCAGCAAGGGCACCAACTAGCTCCTCTCGGCGTCCGGGTTGAATCTTAGGAGAGTTTAGCTCCACTTTTATAGGGA
TGATTTAAGTTTAGTTCGTGTGCCAGTCTTAATAAAAAGCAAGCATCTTGTGTAATTAAGGAGGCTGCTCAGTGTTGTAGCCTCACCCAAAAAATA
page-top