Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig1925
Contig Information
Length 1159 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 4 Clones [Download: CSV  ,  FASTA ]
whgc10f11    whgc20c14    rwhgc10f11    rwhgc20c14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit MTN3 [Zea mays]
Score 953
Evalue 5.61335e-101
Total Hit Count 327
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig1925
ACAGCAGACACATCCATCTGATCTGCTTAGTTTAGTTATCGTGCTTTGTACCCGTGATCAGGATGGCAGATGGGCTCTTCTCCATGGCTCACCCGTGGGC
CTCCGCCTTTGGCATCCTAGGCAACATCATATCCTTCCTGGTGTTCCTCGCACCCACGCCGACGTTCCTGCGGGTGTACCGGAAGAAGTCGACGGAGGGG
TTCAGCGCGGTGCCGTACGTGGTGGCGCTCTTCAGCTGCATGCTGTGGATCTTCTACGCGCTGGTCAAGACCAACTCCAGCCCGCTGCTCACCATCAACG
CCTTCGGCTGCGTCGTCGAGGGCTTCTACATCCTGCTCTACGTGGTGTACGCGCCCAGGGCCGCCAGGCACCGCGCCCTCGCCTTCTTCCTCCTCCTCGA
CGTCGCCGCCTTCGCCCTCATCGTCTCCGTCACCGTGTTCCTCGTGCCCCAGCCCAGCCGCGTCAAGGTCCTCGGCAGCGTCTGCCTCGCCTTCTCCATG
GCCGTCTTCGTCGCCCCGCTCAGCGTCATCTTCGTGGTGATCAAGACCAAGAGCGCCGAGTACATGCCCTTCTCGCTCTCCTTCTTCCTCACCCTCAGCG
CCGTCGCCTGGTTCTTCTATGGCCTCTTCACCAAGGACATCTACGTCACCCTCCCGAACGTGGGCGGGTTCTTCTTTGGGGTGGCCCAGATGACGCTCTA
CTTCTGCTACCGCAAGCCGGACACGTCGGCCCTGGTGCTGCCGACGGGGATCCACGACGTGTCCACGGAGCCGGCGGCGCAGCAGGAGGTGGAGCTGCCG
GAGGGCACCCACCCGGCGGTGGCCATGCTGACGGTGAGCACGCTGCCGATGCTGGCGGAGCTGCAGAAGATGGAGCAGGAGATCAGCTCGCCCACCCCGC
GCAAGGGCTACATCAAGGCTTTCTGATCCGATCCACGACCCATGCGTACGTACGTGCGTGGAGCTACCTGCTGCTTCACGCGCTTGGCTCACCATGGATG
CTTAATTAGCGATGAATCGCTAACGATTTGCGAACCGACCGCCAGCAGAGATACGTTTATATAGTTCTTAATTTCAGTCGTTCGTTTGTAATGGTCCGTA
GTAGTGGCACATTCGTGTGTTGTCGTCCAAGGGTCTGATATGCCGGCCGGCCGGGCAAT
page-top