Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig1923
Contig Information
Length 641 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 4 Clones [Download: CSV  ,  FASTA ]
whgc10e14    whgc10f01    rwhgc10e14    rwhgc10f01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative elongation factor 1 beta [Hordeum vulgare subsp. vulgare]
Score 448
Evalue 7.13831e-43
Total Hit Count 381
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig1923
CTCAACTACTGATGTGGCTGAGGCTCCTGCAGCTGATGATGACGATGACAGCGATGTTGACCTTTTTGGAGAGGAAACCGAAGAGGAGAAGAAGGCAGCT
GAAGAGCGTGCTGCCAAAGCTAAGGCTTCTACCAAGAAGAAAGAATCTGGCAAGTCATCAGTTTTGCTTGATGTTAAGCCATGGGACGATGAGACTGACA
TGGTCAAGCTGGAGGAAGCTGTCCGAAGCATCAAGATGGAGGGCCTTCTGTGGGGTGCTTCCAAGCTCATGCCAGTTGGATATGGCATCAAGAAGCTCCA
GATTATGATGACCATCATTGATGACCTCGTCTCTGTCGACACTCTTATTGAAGACCATCTCTGCGTTGAACCAGCCAACGAGTACATCCAGAGCTGTGAC
ATTGTTGCCTTCAACAAAATCTAAATCTTCCTGAGGCAGGTGATGGCGGTGGGTGGACAATGCAGCAGCACAATATATCTACAGTTTTCCGTTGCCGTGA
TGGTGTCGTAGCTAAAGCAAGCATAACATATCTGCCCTGTGAGGTTTTTGGACCTTAGGTCGAGTTGAGTCGTAGTGTTATTACTGAGTGTTATTTGCTT
CGTATGAAATGAGACAATGTGGTTGGATTCCAAAAAAAAAA
page-top