Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig1917
Contig Information
Length 1554 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 4 Clones [Download: CSV  ,  FASTA ]
whgc10b06    whgc12i15    rwhgc10b06    rwhgc12i15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_25805 [Oryza sativa Indica Group]
Score 719
Evalue 1.14454e-73
Total Hit Count 185
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig1917
ACTCTTTCCCCTCCGTCCGTCCCCTCCTAAAACCCTAGCAGCCCAGGCGGCGGCCTCCCCCCTCCACCACCGCGCCGCCCAAACCCCCAGCCTCTCGCCG
TCCGGAATGGGGCGCGTCGACGGAGAAGACAAGGCCGCGCTCTCCCCCGGCGGAGACGACGCCGCCGATCTCTCCCCCGACGATTCGCCGTGGAGCGACA
GCGCCTGGTCCGAGGACGAAGACGATGACGAGGCCTCGCTGTCGTTCGAGGACAGCGGCGAGGGCTCTGACGTCGACTCCGACGGCCTGGAGGAGGAGGA
TGACGCCGCGGCGGAAGAGAGCGACTCCTCTGAGGACGAGGTTGCGCCGCGGAACACCGTCGGGGACGTGCCGCTTAAGTGGTACAAGGACGAGGAGCAC
ATCGGGTACGACATCTCCGGGAGGAAGATCAAGAAGCGGGACAGGGATGGCAAAATCGACAGCTTCCTCAGCAGCAAAGATAACGATGATGACTGGAGAA
AGCTTTGGGATGACTATAATGGCGAGGAGGTGAAGATTACCAAGGAAGAAGCTAAGATAATTAGTAGACTGATGAAGGGGAAGACTCCACACGCCAATGT
TGATCCTTATCCAGATTATGTTGACTGGTTTGAATATGCTGATAAAGGCCATCCACTTTCTAACGCTCCTGAACCAAAGAGGCGATTTGTTCCCTCAAAG
TGGGAGCAAAAGAAGGTTGTTAAACTCGTTAGAGCCATTCGTAAAGGATGGATCAAGTTTGACAAGCCAAAGGATGAGCCAAACTATTACCTCTTGTGGG
GAGATGACACTGATACAGCAGACAATAAGCGGCAAGGCTTGAGCTACATCCCTGCACCTAAACCAAATTTGCCTCGTCATCGGAGGATTGTACAGCTCAT
GTGTTCCATGGGATGGTCTATGCTGATCTCAACCAGAACCCACTTATTGTGCCACTGGAGATTCTTCGTGGCCATTTGAGTTCAGATAGAAGAGGAGTTT
TGGATTGCAAATTCCACCCAAGACAACCGTGGCTGTTCACTGCTGGCGCCGACTCGGTGGTTAGGCTTTACTGTGATTGATGACGATGCCTTCAAGGAGC
ATGCAGTTTTAGGTGCCAATCTCCACGTGGGCTTTTCACGATGATGATGATGTTCTGCCGTTTTGCCAAGAGTCACATGCCGGAGCCAGGAAGGAATTAC
GTCTCGTTGCGATTTGTGATCTTAGTTTTGTTTGGAGAGATTGTTGTATCTTTTTTTATTCTTGTTATATGTGTAACAATTAGTAGATGAGAGGGAAAAG
TTAGCTGTGTAATAACAGCAGAGTGTGGAAAGATAAGTATTCTATTCCACACGTAAATTTGGAGCTGCCGCTTCTTTTTTCTTTTTGATGAGATGTATTC
TTGTTCAGTTACATGGTCTCCAAGGCCATTGCAGCTGCGCATCAGCATGGCTGCTGCTGCCGCCGCCAACGTCCAAGGGACTTTTGGCTGCCTGCTGAGC
CACATCGTCGTGGTGCCCACACTGTAGGATGGCTTCGAAGACGCTCTTCAAATT
page-top