Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig1914
Contig Information
Length 791 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 4 Clones [Download: CSV  ,  FASTA ]
whgc10d12    whgc14m17    rwhgc10d12    rwhgc14m17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cyclophilin A-1 [Triticum aestivum] >gi|13925737|gb|AAK49428.1|AF262984_1 cyclophilin A-3 [Triticum aestivum] >gi|156193317|gb|ABU56010.1| cyclophilin 5 [Dasypyrum villosum]
Score 843
Evalue 1.72832e-88
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig1914
AAATCCCCATCTCAAAACCCTAGCCCTCATCCCCGATCCCGGCGAGCGAGATGGCCAACCCGAGGGTGTTCTTCGACATGACCGTCGGCGGCGCGCCGGC
CGGGCGCATCGTGATGGAGCTGTACAAGGACGCGGTGCCGCGGACGGTGGAGAACTTCCGCGCGCTGTGCACCGGCGAGAAGGGCGTCGGCAAGAGCGGC
AAGCCGCTGCACTACAAGGGCAGCGCCTTCCACCGCGTGATCCCCGACTTCATGTGCCAGGGCGGCGACTTCACCCGGGGCAACGGCACCGGCGGCGAGT
CCATCTACGGCGAGAAGTTCGCCGACGAGAAGTTCGTCCACAAGCACACCAAGCCCGGGATCCTCTCCATGGCCAACGCGGGGCCCAACACCAACGGCTC
CCAGTTCTTCATCTGCACCGTCCCCTGCAATTGGCTCGACGGCAAGCACGTGGTCTTCGGCGAGGTCGTCGAGGGCATGGACGTCGTCAAGAACATCGAG
AAGGTGGGCTCCCGCAGCGGCACCTGCTCCAAGCAGGTGGTCATCGCCGACTGCGGCCAGCTCTAGATCCGCCCGCGCGCGGGTCGCCTTTCGCCGTCGT
CGTCGCCGCCCCGTGTGTCCCGTGTCGTGTCGTCGATCTAAATAAGAGAGTCGTGTGTCGTGTCGTGTCTTCCCCTGGTCCGTCCGATGAGATCTCCGTG
GTTGGTTTAGGAGGGTTTTAGGTGGACTCTTTGGGCTGCTGGATCTCTGTCCGGCCGCCTTGGTTATCTTCCTGTGTCTGCTGCTATCTTA
page-top