Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig1905
Contig Information
Length 784 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 4 Clones [Download: CSV  ,  FASTA ]
whgc10b09    whgc18c21    rwhgc10b09    rwhgc18c21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit calmodulin2 [Zea mays] >gi|747917|emb|CAA54583.1| calmodulin [Zea mays]
Score 632
Evalue 4.98644e-64
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig1905
GACCCCCACGCCATCATCGCCCATCAACGCGCAGCTCGCGTAACATTTGCAGGCCCTCGTCGCCCCTTGGAGGTTTCGGTTTGCCATGGCGGACCAGCTC
AGCGAGGAGCAGATTGGCGAGTTCAAGGAGGCCTTCAGCCTCTTCGACAAGGACGGCGATGGTAGCATCACCACCAAGGAGCTTGGAACCGTGATGCGCT
CCCTCGGCCAGAACCCTACCGAGGCGGAGCTGCAGGACATGATCAACGAGGTGGATGCGGACGGCAATGGCACCATCGACTTCCCAGAGTTCCTGAACCT
GATGGCCCGCAAGATGAAGGACACCGACTCTGAGGAGGAGCTCAAGGAGGCGTTCCGCGTGTTTGACAAGGACCAGAACGGTTTCATCTCTGCAGCGGAG
CTCCGCCAGGTGATGACCAACCTCGGGGAGAAGCTGTCGGAGGAGGAGGTGGAGGAGATGGTCCGCGAGGCCGATGTGGACGGCGATGGCCAGATCAACT
ACGACGAGTTCGTCAAGGTCATGATGGCCAAGTGAGGAACCACCCCCTCTGAAATAACCCTTTCTATTTCCGCCGAATAACGAACCGTCTGGCACCACTA
CTTCATAACAATTTTTACCTTATTATTACGTGCACGCTGCTGGTACTGACACTTGTTGGCTAGGTGTAGTCACTGAGGGGAGAAGAGGCCAGATGTTATT
TTTTTTCTTCTCTTGGTCACGGACTTCTCCTGTACTCGCTGGATTTGGTGTTTTTCTTGGTTGGGTTGCTTCTTGCTTCATGCT
page-top