Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig1691
Contig Information
Length 980 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 12 Clones [Download: CSV  ,  FASTA ]
whfl3k03    whfl48n07    whfl46a23    whfl47e23    whfl35k06    whfl54f10    whfl10a12    rwhfl2p03    rwhfl29j08    rwhfl44n16    rwhfl31i20    rwhfl53n08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 586
Evalue 3.81998e-78
Total Hit Count 79
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig1691
acTCCCACAGCTCCCACCGTTCTCCAGTCGATCACGCACGCTCTCCTCGCCGCCGAGATGTTCGGGTTCGGGCACCACCACAAGGACCAGGCGCCGCCGG
CGTCGGGCCCCAACCAGATCTTCAAGATCTACTGCCGCGCCTCCGAGGACTACTGCCTCGCCGTCCGCGACGGCGAGGTGGTGCTCGCCCCCGTCAACCC
C*AAGggaCGAGACCCAGCACTGGCTCAAGGACATGCGCTTCAGCACCACCGTCAAGGACGAGGAGGGCATGCCGGCCTTCGCGCTCGTCAACAAGGCCA
CCGGCCTCGCCGTCAAGCACTCCATCGGCCAGTCCCACCCCGTGAAGCTGGTGCCGTTCAACCCGGCGTACGAGGAcgagtCGGTGCTGTGGACGGAGAG
CCAAGACATGGGCAAGGGCTTCCGCTgcgtgCGCATGGTGAACAACATCTACCTCAACTTCGACGCCTTCCACGGCGACAAGGCCCACGGCGGCGTCCAC
GACGGCACCGAGGTCGTGCTCTGGAAGTGGTGCGAGGGCGACAACCAGCGCTGGAAGATCCTCCCCTGGTAGATGAGATGCCAGGAGAGCTTTCGCATTG
CCATCGACACATCGCCATGGATTAGTCCGGGGACAAGCCCCCCCGCCCCGAGTCGTCGTCCGTCCGTCCATCGTCGTCGTAGTAGTCCTCTGCCGCTGGT
AGCGAATAATGTTGCTGTGTCCAAATAAAACCGTGTGCGATGTGTGGCAATGGTGTCTGTGTGCGTCCGTCGTGTGTCGCCTTGTGATTGAATGATTGAG
CCGGCGTTTCTGCGAGGAAGAAGAGAGTGTTGGAGAGAGTGAGGAGAGGGACCATGATTCTGAAGTCTGAACTTTGATGTAGTAACTCGT*CTGTGTTTC
TCTTGGTACTGGGACCTGTACTGTGCTACTCTGTGACCTGCATTGTCTCCATTTTTCTGCGATCTAATCAAtgggctcac
page-top