Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig1686
Contig Information
Length 853 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 12 Clones [Download: CSV  ,  FASTA ]
rwhfl53p03    rwhfl18c17    rwhfl33l11    rwhfl10c04    rwhfl53p04    rwhfl24a23    whfl33l11    whfl18c17    whfl10c04    whfl53p03    whfl53p04    whfl24a23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative spindle disassembly related protein CDC48 [Nicotiana tabacum]
Score 743
Evalue 7.76346e-77
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig1686
gcTGGAAATAACGGGCAGAACGATTAACTGTGCATCACAATATTAACTTAAGAACATAGTTTTCCCGTGTACTGCGTACCGGAGCACAACATCTACGAAC
GAAATCAACAAAGCGAAAGGATTTAGCTATATAAATCATCATCGTCAGCTGCTGCAGCAGCGGAAGCAAAAGGGTCGGCCGCAGCGGCAGAGGAAGCACC
CGCAGCCGGCTGATCAGGGAACCGGAACTCGCTGCCAAATCCACGAGACTGCTGCAGAGTCTGGGCAAAGGCCTGGTACTTGCGGATGTCGGCATCGCTC
ACACTCCGGCGCGCATACTTCATCGACTCCTCAAAGTGGGCAGCCCTGATCTCAGCAACCTCATCAACCTCGTCCTCC*TCCATGGCTTCAGGGTTGTCC
TTCCTCCGCCTCTCCCTCTCGATGTCCTTCTCGATGTTCTCCCTGATGGCATACTTGCAAGCACGCTGGCAAATTTCAGTGATATCAGCACCGCTGAACC
CTTGAGTGTACTTGGCAAGAGCACTCAGATCAATATCCTTGGCCAAAGGAGACTTTCTGAGGCAAGCTTTGAAGATCTGGTGCCTCGACTCAACATCAGG
AAGAGGGATGTAGATAAGCTGATCAAGACGCCCTGGCCTAAGCAGGGCAGGGTCTATGATGTCTGGCCTGTTGGTAGCACCAATGATGAAGACGGTTTTC
TTAGCATTCATGCCATCCATCTCAGTCAGCAGCTGGTTCAGCACTCTATCAGCAGCACCTCCAGCATCCCCACTGCTGCTTCCTCTCTGGGTAGCAATAG
AGTCAAGCTCATCAAagaagagcacggttctcgagtcatcgctgttccgatga
page-top