Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig1783
Contig Information
Length 774 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 4 Clones [Download: CSV  ,  FASTA ]
whgc10f15    rwhgc10f15    rwhgc5e24    rwhgc16k07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit integral membrane family protein-like [Oryza sativa Japonica Group] >gi|125554646|gb|EAZ00252.1| hypothetical protein OsI_22263 [Oryza sativa Indica Group] >gi|125596586|gb|EAZ36366.1| hypothetical protein OsJ_019849 [Oryza sativa (japonica cultivar-group)]
Score 571
Evalue 5.72091e-57
Total Hit Count 102
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig1783
ACAAAGGCCGATACAAAAGAAGTAACACCGTCAAGGCAGTGCACAATATAGAAGATGGTAGCAAGAGAATAGGCCCACACATTATTACATGAAGGAAGCA
AGTACAAGAACCACCCTCACACATATTTTTTTGTGCTGGGATATCACACTTATACTTCAGGGAGCAAATGATGGATAATTCGGTCTAGCGCCTGGCTAGG
GCCATGGCTGAGAGTAAGATGAGCAGTATCAGCAGAACCATGGCTCCAAACGAGCCAACCAGGGAGCCAGAGGTACGCTCGCAGAAAGAATCCAACTGCT
GGCATATAGCAAGCCAGTTTGCCCTGACATTACCCTTGTGTGCTAAGTAGACAATAGCTGTTGCTGCAGATGACGCTGCGGTCACCAGAGCTAGCATTGC
CGCGTCGAAAATGATCAAGACCAGCCTGCTATATTTAGCCCCGCTCCTAATTATGTGCGCAATTGACAGTGGGAGCGAAAGGATGAGATAGGCGCTCACA
ATAGAATTTGCCACCACGAAGAACGTGAGAGCCGGGAGATCGCTGTATCGGGCCTTGAACTGGATGAATGGCGTGAACAGAGGAAGCGTCTCATTGGTAG
TCCCCATGGCAATGGCGCTCGCGAGGGTGCTGATGACGGCAATGACGCGAAGTATGAGGTCCAGTATGGACACTCCTCTACTTACCCCCTTGTTCAGGGG
GGCCTTGGAGGTCTCACCCTGCTCGCCGGAGTCCATTCTGGTATTTTTCTTAAGCTGCTGAACTGATCAAAACT
page-top