Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig1682
Contig Information
Length 587 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 12 Clones [Download: CSV  ,  FASTA ]
whfl16j10    whfl17a09    whfl7e07    whfl28n12    whfl29l17    whfl8c18    whfl52g19    whfl10a13    whfl28d04    whfl6j13    whfl28d15    whfl30k16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit alcohol dehydrogenase ADH1 [Triticum urartu]
Score 765
Evalue 3.34773e-89
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig1682
acGGATTCGTTGATCCTGTGAAGTGAGAGATCAGTTCTCGATTTCGATTCCGGTTCCGCTCAGAGAATTCCCCAGGCGAGCGAGCGAGATGGCGACCGCC
GGGAAGGTGATCAAGTGCAAAGCCGCGGTGGCGTGGGAGGCGGGGAAGCCGCTGTCCATGGAGGGAGGTGGAGGTGGCGCCGCCGCAGGCCATGGAGGTG
CGCGTCAAGATCCTCTTCACCTCCCTCTGCCACACCGACGTCTACTTCTGGGAGGCCAAGGGGCAGACTCCCATGTTCCCTCGGATCTTCGGTCATGAAG
CTGGAGGCATAGTGGAGAGTGTTGGAGAGGGTGTGACTGAGCTTGCCCCTGGTGACCATGTCCTCCCTGTGTTCACTGGGGAGTGTAAGGAATGCCCACA
TTGCAAGTCTGCAGAGAGCAACATGTGTGATCTGCTCAGGATCAACACCGACAGAGGTGTCATGATCGGGGATGGCAAGTCACGCTTCTCTATTGACGGG
AAGCCGATTTACCATTTCGTAGGGACTTCCACCTTCAGTGAGTATACTGTCATGCATGTTGGTTGTGTTGCcaagatCAACCCTgag
page-top