Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig1745
Contig Information
Length 516 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 3 Clones [Download: CSV  ,  FASTA ]
whgc14n17    rwhgc10e24    rwhgc14n17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Acyl-CoA-binding protein [Panax ginseng]
Score 367
Evalue 9.83008e-34
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig1745
TTACATGAATCAATCATGGCGTAAACTCAAATATCACAGGCGGGGCTTGTTCAACGTAATTACACCCAATACGACGATAAGCTTAGACAGATAGCACTTC
AAATTTATTTGTGTTTATTGGCACATATGTCTGCACCACCATGGATAAAAGTAGGTTCTGTGGCCTAGGAAGAAGCGGATGCGGCGGCAGCCTCCTCGAG
CAGCTGCTTCACCTTGGTGATGTAGTCCGCCATCGCCTCCTCCTTGGATTTCGCTTCGACGGACTTCCAGGCGTCCCACTTGGCCTTGCCCTTAAGGTCG
AACATTCCGGGGCGGGCTGTGTTGACGGGCCCGACGGTGGCCTGCTTGTAGAGGCTGTAGAGGCAGAGCATGCTCTCGTTGGTGGTGGTGTCGGGCAGCG
TCTTGGCCTTCTCCGCGTACTCCTCAAACTCCTCCTGCAGACCCATGTCGATCGGCTCGTCGGCTGCTCCGCTCTCCTCGGCTTCGATACGTTCGAGGCG
ATAAGAACGATCGATT
page-top