Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig1727
Contig Information
Length 737 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 3 Clones [Download: CSV  ,  FASTA ]
whgc6g05    rwhgc6g05    rwhgc3j04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cyclopropane fatty acid synthase [Zea mays]
Score 636
Evalue 1.52167e-64
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig1727
CCACCTTACAAGTATGACGCAATCATAAGCATCTGTATGATTGAACATGTTGGCCATGAATGCATGGATGAATTTTTTGCCTGCTGCGAGTCTTACTTAG
CTGAAGATGGCATAATGGCCCTGCAGTTCATCTCAGCTCCAGAGGAACGGTACGAACAATACAGAAAAAGGCCAGACTTCCTAACAGAATACATATTTCC
TGGTGGTTGCCTTCCTTCTTTGGCCCGTGTAGTGTCTGCCATGAGCACATCATCAAGGTTCTGCATAGAGCATGTCGAGAATATTGGGCCCAATTACTAC
CCAACTCTGATGTGCTGGATGGACAACTTCACTGCCAACAAAGATAAGATGTTGGCCCTGGGCTTTGATGAGAAGTTCATCCGTATATGGGAGTACTACC
TCATATTCTCTGCGGCTTGTATGAAGTCACGGACACTTGGAGTTTACCAGGTTGTTTTCTCTCGCCCAGGCAACCGTCGGCTAGGCCAGCCTTTGGCTAA
AGCCTAAAGGCAACATATCCTTGTCCGTTCAGTTCTTGAACTGTTACTCACTTACTCCTCGATAGCCTATGACCTTTTAATAAGTCAGCCCTGGAATGGT
TCGTTCATACGGGCAGCCTAATCAGGCGGTTTGTGGATCTATCTTGTTGTTTTAAACATGGAATGTTATTTTCATGGCAGTGTGTTATCTATAAATAAAC
TTCTATGTGTGTATGCAAGTGCTACCTTATACTGGTC
page-top