Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig1637
Contig Information
Length 718 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 3 Clones [Download: CSV  ,  FASTA ]
whgc19o06    rwhgc19o06    rwhgc3g15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit glutamine synthetase isoform GS1b [Triticum aestivum]
Score 631
Evalue 1.83537e-68
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig1637
ACATTTTTTACATATCAATTGATGATTACACGAGGACCAGAGCACCCAAACGGCAAGGGAAAACAATCAATAGTAGCCTTGTGTGTTTGACACGCCTCTT
GCCACCCACCACCCAGAGACGAGAGAAGAGCGACCAGACACCCTGATGCATGACGACGACGACGATGATGCGACCTACCTAAGCGGACTACGCGTAGTAT
GCAACCAAACGGAAAATCAAATATGTTGGAAGAATTTCGTCCAAATCCTCCAGTGGCCACCCACCAAATCCAACCCAACCCATCACTGATCATCGCACGG
CGATCGGCGCCGATCGGCTTCAGGGCTTCCACAGGATGGTGGTCTCGGCGATCATCGAGGTGACCACGTATGGGTCCATGTTGGACGCCGGCCGGCGGTC
CTCGAAGTAGCCCTTGCCGTTCTGCTCCGTCTCCCGGCCCACGCGCACCGACGCGCCACGGTTTGCGACGCCCCAGCTGAAGGTGTTGATGTCGGCGGTC
TCGTGCTTGCCGGTGAGGCGGCGCTCGTTGCCCTCGCCGTAGGCGGCGATGTGCTCCTTGTGCTTGAGCTTGAGCTTCTCCACGGCATCCACGATGACCT
TGAACCCGCCGTCCTTCCTCATCGACTCGGTACTGTAGTTTGTGTGAGCACCAGCACCGTTCCAGTCGCCCTGGGATGGGCTTGGGGTCAAATGTGACGA
CNACTCCNGCGATCTCAC
page-top