Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig1634
Contig Information
Length 785 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 3 Clones [Download: CSV  ,  FASTA ]
whgc12m21    rwhgc10a10    rwhgc12m21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_34040 [Oryza sativa Indica Group]
Score 381
Evalue 6.3519e-35
Total Hit Count 343
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig1634
CGAAGGAAATACATGGAACCCTGATTCATCAACTGGGAACATGATACATAGAGTGAGTGATAACATGGTTCAGCTGAATACACCATCCATTTGGCGAGAC
AAGCTGACTAACATTGTTGCATCATCCATATACCTAGTCACCTAGAAATATATGCGTGAATCATCTCACTTCTCAAATCCGGCTCATTACTACTAATCAT
CCCACAAGTTTTTAGTAGTGCTACCACATCATTATCTCACATATAAGTTTACTTAGTAGGATGAAAGGGTGTTATCTCTCCATCAGGCCATGAGGTAAAG
ATCTAGCCATCATTGGATGAACCAACGATAGTGAGATCTGCCTTCACAACGCAGCTCGATCCTACAACATAGCCTCCCGACGGATCCTTGAGTTTCTTGA
GTCCAAGGAAGTTAGGCCATCCCCATCCTTGTCCACATACCCAGAGACCTGAAGTTCTAGTGAAGTGTTTCCCATTCTTTTGGTCCAGGATGGACAGAGT
CATTACAGCCACCTTCTTGGACTCGAGTTGGAGCTCATCCGAGGCATCCGGGTATAAGTACAAGCTGAGGCAATCGGTGCTGTACTTGTCACCACGCGGA
TACATGCCGATGTACCAATTTTGTCCGCCAACTTCAAATGTAGGAGACTGGATGAAGTGCTTCAAGTCCAATTCAAGGAAATTGTTCATGGTCCAAGTGT
ATGTCCCTTTGATGAATCCCTTACTCTGGACAAAGAGGTTCTGAACTATGGTAGCCTTCTTCTGAACCACAACAGCCTTCTTTTC
page-top