Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig1618
Contig Information
Length 669 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 3 Clones [Download: CSV  ,  FASTA ]
rwhgc10e17    rwhgc18h18    rwhgc18j20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit plasma membrane intrinsic protein [Hordeum vulgare]
Score 655
Evalue 7.81186e-67
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig1618
GGATCGATCATACATATGGTCGCTAAATTTAAATACAAGTAGGAAAAGCAATGCGGGCTAATTAAGACAAGCGATCCCATGGACCGAATTACAAGACACG
GCACGCATGACCGGACCACGTACTACGCATATGCAGCTGCCGACACATAATAACACGACCATTGCGGCGGCCGAACTGAACTGTCGAGAAGTTGCAAAAG
CGCATTTCTCTCTGGATGGATGGACACAACACGGGTCGCCATTGCTTCAGTCTTGCATACAGATGACATGGATGATAACTTGTTACGCGTTGCTCCTGAA
GGAGCCGAGGGCCTTGATGGCGCCGGCCCTGAGGATGTACTGGTGGTAGAAGGCCGCGATCGCCGCGCCGATCATGGGGCCGACCCAGAAGATCCACTGA
TCATCCCAGGCCTTGTCCTTGTTGTAGATGACGGCGGCCCCCAGGCTCCGGGCCGGGTTGATGCCGGTGCCGGTGATGGGGATGGTGGCCAGGTGGACCA
TGAACACGGCGAAGCCGATCGGGAGGGGCGCCAGCACCGGGACGTGAGAGTCGCGTGCGCTGCGCTTGGGGTCGGTGGCGGAGAAGACGGTGTAGACGAG
CACGAAGGTGCCGATGATCTCCGCAGCGAGGCCGGTGCCCTTGGAGTAGCCGGCGGCNANCGTGTTGGC
page-top