Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig1583
Contig Information
Length 854 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 3 Clones [Download: CSV  ,  FASTA ]
whgc11n02    whgc2h02    whgc20b14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_12360 [Oryza sativa Indica Group]
Score 675
Evalue 5.9978e-69
Total Hit Count 411
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig1583
GGCGGCGAAGATGGTGTCGCTGAAGCTGCAGAAGCGCCTGGCCTCGAGCGTCCTCAAATGCGGCAAGGGCAAGGTCTGGCTCGACCCCAATGAGGTCAAC
GAGATCTCCATGGCCAACTCCCGGCAGAACATCCGGAAGCTGGTAAAGGATGGTTTCATCATCAGGAAGCCTCAGAAGATCCACTCCAGGTCTCGTGCAA
GGAGGGCACATGAGGCCAAGCAGAAGGGCCGTCACTCTGGATATGGTAAGCGTAGGGGTACCAGGGAGGCTAGGCTCCCCACCAAGATCCTGTGGATGCG
GAGGATGCGCGTCCTGAGGCGCCTTCTGCGCAAGTACCGTGAGGCCAAGAAGATCGACAAGCACATGTACCATGACATGTACCTGAAGGTCAAAGGTAAC
ATGTTCAAGAACAAGAGGGTCCTCATGGAGAGTATCCACAAGTCCAAGGCTGAGAAGGCAAGAGAGAAGACCCTCTCTGACCAGTTTGAGGCCAAGCGCG
CCAAGAGCAAGGCAAGCAGGGAGAGGAAGATTGCCAGGAGGGAGGAGAGATTGGCCCAGGGCCCGAGAGATCATGCACCAGCACCAGCGGCTGCAGCTCC
AGCTGCGGCACCAAAGAAGGCCAAGAAGTGAAGTTCTGACATGAAGCTTTAGCTTTCTGGTACTATGAAGGGTTAGCCTAATTTTGGAACATCAGAAGTT
CAGAACTGTTTCCTGTCCAATATCTTGTTTGTGTCAGCGTGTCAGATACCTTAAATATCATATCGTGTTTATTCTGTTGGATGCAGAGTTTGTTAAAACA
TTTGGGTTCACGGTATTATATTATGCTTTTGAACCTAGTTAAACAAAAAAAAAA
page-top