Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig1579
Contig Information
Length 829 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 3 Clones [Download: CSV  ,  FASTA ]
whgc3b05    whgc3h11    rwhgc3h11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0633400 [Oryza sativa (japonica cultivar-group)] >gi|49388178|dbj|BAD25304.1| putative replication protein A2 [Oryza sativa Japonica Group] >gi|113537041|dbj|BAF09424.1| Os02g0633400 [Oryza sativa (japonica cultivar-group)] >gi|215707148|dbj|BAG93608.1| unnamed protein product [Oryza sativa Japonica Group]
Score 504
Evalue 3.8009e-49
Total Hit Count 151
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig1579
GCGGATCACAGAATGTACGATTCATTCTTGATGATGGTACAGGCAGGATAGAAGTGAATCGCTGGGCAAATGAGACATCGGACAATACAGAAATGGGTTT
AGTCAAGGATGGTGACTATGTTATTGTCAATGGTGGTCTGAAAGGTTTTCAAGGGAAGCGTCACATTGTTGCTTATTCCGTGCGGCTTGTAACCAACTAC
AATGATATAACACATCACTTTCTGTACTGCATTTATGTGCATTTGGATCTTGCCAAGGCTAAGAAATCTGCGACGCAGCCCCAAGTAACTGCTAATGCAT
CAACATGGAACCAAGCTCCACCCCCTAATAATCAGGCCCCAACACTATCTGCATCTGGGAATGCTGGTGGGCAAGAGTTAACTGATATGGTCATGAATGT
TTTTCATGACCCAGTGCTTGTAAACCTGGAGCATGGAGTTAGTATCGCACAGGTTGCAAGCCGTCTTAACATATCAGATGCACTTGCCAGGTCGACTGTT
GCACATCTTATTGATCTTGGCAACCTCTATCCAACTATTGATGACAACCATTACAAGTCTACACTGAATGGTTGATATGGCTGTGTCCACGCATGCAAGA
GTTAGGCTCCCCTGGAGCTATCGAAATAATATAAGCACTCTTGGAAGAGTTGTTTTTGCAGAGTGGCTTGCTGGTCCTCTAGACAGTCGCAAGGAGAGCA
ACTTAACGGCTAGGTTAAGTTGCATATCTAAGTACTTGCGCCTTATATGTAATGGTCTAATGGACATGAGTAGGTTAGATCTCTAGGTGCTTTGTTTGTG
TTTGCTACTGCAGTACCTCCAGAACATCC
page-top