Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig1548
Contig Information
Length 833 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 3 Clones [Download: CSV  ,  FASTA ]
whgc10e04    rwhgc10e04    rwhgc17h05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit proliferation-associated protein 2G4 [Zea mays]
Score 627
Evalue 1.06703e-72
Total Hit Count 315
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig1548
TTTTTTTTTTAGTGGAACTTACTGCCGGATTTATAAGCATTACTGACAGGTAAACATTCAGCACACCATACATAATTATCAGGCTTGTACTTCGATGTGA
TGTGCGCCAGGATCAACCATTTTCATTAGACACTTCAAAAAAAGGTACTCAAATCCCCACAGCTGAATGTAATATAAAACAATCAGATGCAGCAAAGGAG
CAGGTACAAACGTAACGGAAGCAATTCAAAAAAAATGAGAATTATTCCTGGCTTGGTGCGTCCTTAGAAACCTCCATGGGCTCTGCTACTTCTGCTGCAT
CTCCTTTCTTGCCTTTCTTTTTCTTGCCACCACCCTTCTTCTTTGACTTTGTGCCCAAAGCCAGCCAAGCCTTGATCTCAGCATCGCCCTCGATGGATTT
TGAGGGCTCCAATTGCTGTAGTGGATGTGAAGTTATCTTGTCAGACCCATTTGGCATCAACAACACGGTGAACTTGATGTGGGCAACCAGGTCACCTTGC
TTCTCATGTAGAACAGGGTATGGCTGCAACAGCTCATGATTCATGCATTCTACCAAACCTAAGCGTGCACGCTTCTCCTCCAGCGCCCTAGCAGTGAATG
GCATGATTGGGAACTTCTGGCTAATCTCACTGAAGATGAACCTTGATGCCTTCATCTTCAAGTGATAGTTCTTGTCTACAGCTCTCTTGTAAATAGTGGT
CTGCTTCTCATCCNAATAGCTTCGGCTTTCCCTCGCCAGTGCTGGTGACAATATCAATTGCATACACTTCATTTTCTNCAATTCGCATCATCCACCTTTG
TATCAGCATTTGAAACACTAAGTACCCACTTTG
page-top