Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig1547
Contig Information
Length 869 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 3 Clones [Download: CSV  ,  FASTA ]
whgc10f06    rwhgc10f06    rwhgc10f17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Glycine Rich Secreted Protein family member (grsp-2) [Caenorhabditis elegans] >gi|34555797|emb|CAA90992.2| C. elegans protein T28C6.1, confirmed by transcript evidence [Caenorhabditis elegans]
Score 106
Evalue 0.0058426
Total Hit Count 122
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig1547
AATCTTGACAAAGCAAAGTTTGGCCATTTTAACCACCATCCAGAAAACACAAGCCACATAAAAGGACCACTATTTACTGTTCTAAAAGTGTTCAGCCACT
AAATGGTCCAAAACACTTAAGTCACACCCATGAGCACAAGATATATGCTCCAAAACACTTGAAGTAGCAAATGGTCCAGAACACACATAAGATTCACGAT
CACAAGTTGGCTGGTCCAAAATACTCGAAACAGCCAAATGCTGCATAACACTCCGAAGTCATCACATCCATGCGCAGTAGGTGGCTGAGTACATCGCTTA
TTTCTTATGCAAACTATTCCAGTTCATAGGCTGCTTCTTCCACTGCATGTTGCTCTGAAAAATGTGAAGACATGCATCAACCACCCTAACAACGCACACC
CCCTCCAGCCGGAGGTGCTTCCGTAGTTATGGAGATGCTGGCGCTTGCAGATGGCAGTCTCCTACGCTGGTTGGCGGCGGCGCTAGAATATCTAAACGGC
ATTGACTTGGTCTTTGGGTGGGGAAGGGGGGGTTGGGCGTGCTCGGTCAAGGCGACGGCGGACGGAGCTGCCGGCGGCTGTGACTCCAAGGAAGGAAGGA
TGGGATGGGGTCGGGGAGACGGGGACGTGGAATGGGGTTGGGGGCGGTGGACGGAAGGATCTCGAGGTCGGTGTATCGGCGGCTGCGACCCCGGCGCCGT
GGTAGGGAACATGTGTCGATGGGGTGGGGGGAAGCGTGAAGACGATGGCAGCAAGGACGAGGGTGACGCTGGAGCGCGAGGACGGCGACGGGAGGGCGGC
GGGGACATAGGTGGTGGAGCGCCGGCAGGGCGGCGGGGATGGAGTGCGGCGGCGGCGGTAGGGAAGTGG
page-top