Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig1541
Contig Information
Length 726 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 3 Clones [Download: CSV  ,  FASTA ]
whgc10g09    rwhgc10g09    rwhgc1j16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_36489 [Oryza sativa Indica Group]
Score 554
Evalue 4.73426e-55
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig1541
GTAGTGGTTTATATATATCAAAGTTATCCATTAATCTTGTTTGTAGTAAGGATTACAAGCTAAGATAACTTTACCGGCTCTAACTAGCACATTATGTTCG
CTCGAGAAAAAAAAAGTAGCACATTATGTGCAAATACATTTTTATTTTGACATGTATCTTTTGAATGCAGATCTATGCTGGATCCGGGTCTTGAATGCAG
TAGTAGTGGTACAAAGTGTCACCGCCTCGAGCCGTAGCCAACTTCCTTACCGTTGCTACATCATAGTATCATACTAGTTTTGACTCTTGAGGAAACATTC
AGAAAGCTCATATCCACTTGCTGATGTTTAACCACCATTTTTCATTGTGCAGTTCCCATCTTGGCATCCTTGTACAGCTGATCAACACGATCCTTGTAAT
GTTTGAGCAGCTGGGGCCTCTTGAGCTTAAAAGTTGGGGTGATCAGGTCCTTGTCGATGCTGAATGGCACTGGCTCCAGGTGAACGGCCCTCAGCATCTC
AAATCCTCTCAACCCGAGTTTCTTGCCGGTTTGATTCAGCTCATCCTGGATGTACCTCCTTGCCTTCGGATCATTGCACAACTCAGCGTAGTCACCAGAC
TTGCCGTTAAGTGCAGCCCAGTCCTCAATGGCTTGCTTCTCAGGGACGACCACAGCAACGAGGAAGGACTCGAAGCTGTTCCCGTANACCCAAACCGATG
CANCGAGTTGAGACTGCGCGTATGCG
page-top