Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig1465
Contig Information
Length 1109 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc10a03    rwhgc10a03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_08115 [Oryza sativa Indica Group]
Score 1099
Evalue 6.23088e-118
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig1465
ATATGCAGGCAACCGTATACTCATTTCCCAAGTATCTGCCAACTCCTCCATCACTTGCTTTTAAAGCTTGAACCCGTGGAATACAAAAAGAGGGAAATGG
AAGTACTAGAGCAAGAGAGGAGCGTGGATACCTTTTCTCCACAAATCATCGAGTTCTTAAACTCCAAGAACAATAATGGTGAAAATGGAAAAGATTGGGG
CAACAAGCTTGAAGATGGCAAAACTGGACCTCCAGGAGAAGTCTCAGTTGATGACAGTACTATGAACGAACATTCAATGAAAATAAAGTTAGATGATGTG
TCTTGTCCTATCTGCAAGGAGCTGCTGTATCAACCTACTGTTCTTAACTGTGGTCATGTGTATTGCATATCTTGTTTGCCTTCCGTGGGTGATGAAGCAT
TGAAATGTCAAGTCTGTGGAGGTCTTCATCCTGGAGATTTTCCTAATGTTTGTTTAGATCTTGACCACTTTCTGGAAGAATATTTTCCAGCAGAATATGA
ATCAAGACGCAAGAAACTTCAGCTTGAGAATAGCCAATGCAATCCTGAAGGATCATCTTCAAGTACTTCATGCAAGAAGGGAGCTTTTGTACAGAAGACT
CTAGACTTATCAAATGTTCACATTGGAGTTGGATGTGACTCATGCGGGGTCTATCCGATACGAGGCAAGCGATACAAATGCAAGGATTGCACAGAGGCAA
TTGGATTCGACCTTTGCGGGGAATGCTACGACAGCACTTCAAAGCTCCCAGGCCGCTTTAATCAGCAGCACACACCTGACCACAGGATGGAACTCGATAA
TTCATCACTGTTTGACGCGTTCCTGAGATTCCAAGGGATACCCGCGGAGGGTCTGCAGCAGCTGGTACAACAAATGGAGCTCATTGGTGCTGGTGGCATG
GTGCAGTTAGTGGCTGATGATGAAGAGATGGAGGACAATCATGAGGATGCTTAGTTGCTGTAGGAACCAAGCAAGCATTTCTAGCAGAGCTGATTTGAGG
AGCGAGCCTTGAAATATTGTGGTGATCGGATTAAATGAATGTAGCGTGCTACATTGTCCTTGATTCCTTTTGGGTCCGAAGGTCAATTAGTCTTGTTTAT
GCTTTCGTA
page-top