Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig1427
Contig Information
Length 660 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc10f21    whgc10l23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0275600 [Oryza sativa (japonica cultivar-group)] >gi|6539559|dbj|BAA88176.1| putative zwille protein [Oryza sativa Japonica Group] >gi|113532253|dbj|BAF04636.1| Os01g0275600 [Oryza sativa (japonica cultivar-group)]
Score 513
Evalue 2.20981e-50
Total Hit Count 258
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig1427
GGGGAGGGGGAGAGACGAGTTCCGAAGGGGAACGGAAAAGAAAGCCAAGCCATCTCTCGCGGAGGCGAACGACAAGGCTTCCTCCCTTGCGCCCTCGCAG
ATCAGTTCAGCGGTTCTGCTCCTCCGGACCATTGTGGGTTTGCTGAAATGGAGTCGCAAGGTGATGACCTGCCACCACCACCACCACTCCCGCCAAATGC
AGAGCCGATAAAAGCTGAGTCGGCTGATGACTTGCCACTACCACCACCCCTGCCGCCTATCANACCTGAAGAAGCAAAGAAGATTTCAAAGCCTAAGAGG
GCCCTGATTGCTCGTCCTGGTTTTGGCAAGAGGGGAAATCCTATACAGCTTGTGACAAATCATTTCAAAGTCTCGTTGAAGACGACAGATGAGTTCTTCC
ACCATTACTATGTAAATCTGAAGTATGAAGATGACAGGCCTGTTGATGGAAAAGGTGTTGGTAGAAAAGTCATTGATAAGCTTTCACAGACTTATGCATC
GGAGCTAGCCCATAAAGACTTTGCCTATGATGGTGAAAAGAGTCTTTTTACCATTGGTGCCCTCCCACAAATTAACAATGAGTTTGTTGTGGTTCTTGAA
GACGTTTCCAGTGGAAAGACTCCTGCAAATGGCAGCCCTGGGAAACGACAGTCCAGGAAA
page-top