Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig1403
Contig Information
Length 362 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc10f18    rwhgc10f18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit polcalcin Jun o 2 [Zea mays]
Score 99
Evalue 0.00986522
Total Hit Count 49
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig1403
GCGTGGACAAGAACGGCGACGGCCTCATCTCCTTCGACGAGTTCAAGGTCATGATGGCCTCCGGCTTGGCCGCCAAGATGGCCTGACCCGTCCATCCTCT
TGTTGATTCAGCGATTTCGTCCACGCCTCCCTCCCTCCTTCCTCTCGCGTGCCGTGCGGTGCGGTGCGGTGCGGATTAAGTGCGAATTAAGTGTACATAA
TTCAAGGATTAAAGGGCGGCCATTAGAGTAGATTATTTCTTTCGTTTCTTGGTGGTGCGAGTAATAACTAGAAATCTCTCGCGAATAACTGTGTCGCGAA
TATCGATCTGAGATCAAAGAGATTGACGAGGCTTGAAGGGGATATAAAAAGCAAAAAAAAAA
page-top