Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig1357
Contig Information
Length 1280 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc10f12    rwhgc10f12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os08g0512600 [Oryza sativa (japonica cultivar-group)] >gi|122222032|sp|Q0J4I1|CKB21_ORYSJ RecName: Full=Cyclin-dependent kinase B2-1; Short=CDKB2;1; Short=CDKB;2; AltName: Full=CDC2Os-3 >gi|113624189|dbj|BAF24134.1| Os08g0512600 [Oryza sativa (japonica cultivar-group)] >gi|218201442|gb|EEC83869.1| hypothetical protein OsI_29856 [Oryza sativa Indica Group]
Score 1474
Evalue 2.50415e-161
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig1357
GGAGAGCGGATCTGCACGATGGCGATGCTCCAGCACCAGAACCAGGGGGCAGCGGCGCCGATGACCACCACGGGCGGCGGGCTGCGCGCCATGGACCTCT
ACGAGAAGCTGGAGAAGGTCGGGGAGGGCACCTACGGGAAGGTGTACAAGGCCCGGGAGAAGGCGACGGGCCGGATCGTGGCGCTCAAGAAGACGCGCCT
CCCGGAGGACGACGAGGGCGTGCCCCCCACGGCGCTCAGGGAGGTCTCGCTGCTGCGGATGCTGTCGCAGGACCCGCACGTCGTGCGCCTGCTCGATCTC
AAGCAGGGCCAGAACAAGGAGGGCCAGACCATCCTCTACCTCGTCTTCGAGTACATGGACACCGACCTCAAGAAGTTCATCCGCGGCCACCGCCAGAACC
ACGAGAAGATCCCCGCCCACACCGTCAAGATCTTGATGTACCAGCTCTGCAAGGGCGTGGCTTTCTGCCACGGACGAGGTGTCCTGCACCGTGACCTCAA
GCCACACAACCTGCTCATGGACCGCAAGACCATGGCTCTCAAGATCGCCGATCTTGGGCTCAGTCGTGCCTTCACGGTTCCTCTCAAGAAGTACACACAC
GAGATCCTTACTCTGTGGTACAGAGCTCCGGAGGTCCTTCTTGGCGCCACACACTACTCAACGCCGGTTGACATGTGGTCTGTGGGCTGCATATTTGCTG
AATTGATCACTACCACGGCACTTTTCCCTGGAGACTCTGAGGTGCAGCAGCTCCTGCACATTTTCAAGTTGCTGGGCACTCCAAATGAGGATGTCTGGCC
AGGAGTAGGCAAACTCCCGAACTGGCATGAGTACCCTCAGTGGAATGTCTCAAAGCTGTCTTCTGTCATTCCTAGTCTCGATGCCGATGGTATTGATCTG
CTTGAGAAAATGCTGCAGTATGAGCCGGCAAAGCGGATCTCTGCGAAGAAGGCCATGGAGCACCCATACTTCGATGATGTGGACAAGGTGCTGTACTGAA
GCTGTCTTCGTGGCTAGCAAGAAGCGGATTTCTTGTGATTTGTGCTTGTCCTGAAGCATATCTTTTGCTTCCAGGGCAGGCATCTTTACCTCTGTTATTC
CAGCTGCCATTTAGTTTTGCCCCATTGACTGATGGTTGTGATGGACGGTGACTCTGGAGTTATGCATAATTAAACGCCTCTTGCCAGGCGTTAAGTACTG
GTCTTCCGAAGCACTACTTCTGCTTCAAAATCAGGCTTTACCTCTTTTTCTGGCTGCTATTTATAGTGTATGCCATTCAT
page-top