Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig1325
Contig Information
Length 942 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc1a04    rwhgc1a04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit casein kinase II beta [Hordeum vulgare]
Score 1133
Evalue 5.49037e-122
Total Hit Count 403
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig1325
GAGCTGCTCGCCGCCGGCAAGATAACCACTCAGATCGGCAAGGTCCCCAAGGTCTCCGACGTCGAGGAATTTGAAACTGATAGTGAAGATTCTGATGTTA
GTGGTTCTGAAGGAGAGGACACATCTTGGATTTCATGGTTCTGTAGCTTGCGAGGCAACGAATTCTTCTGTGAGATTGATGATGATTATATACAGGATGA
TTTCAATCTCTGTGGCCTAAGCAGTCAGGTGCCATATTATGATTATGCACTTGATCTCATCCTAGACATCGAGTCTTCTAATGGTGATGTATTCACTGAG
GAGCAAAATGAATTAATCGAGTCATCTGCAGAGATGCTGTATGGTTTAATTCATGCACGGTACATCTTAACCAGCAAGGGTCTAGCTGCAATGTTAGAAA
AGTTCAAGAACTATGATTTTGGCAGATGCCCTCGTGTATACTGCTGTGGTCAACCCTGTCTTCCAGCAGGGCAATCAGACATTCCTAGGTCAAGCACAGT
GAAGGTGTTTTGTCCAAAATGTGAAGATTTACACTATCCAAGGTCCAAGTACCAAGGCAACATTGATGGAGCATACTTTGGTACGACATTCCCTCATCTC
TTCTTGATGACATACCCACACCTGAAACCACAGAAGCCATCACAGCAATACGTCCCAAGGGTTTTTGGCTTCAAACTTCACAAGCAGTCATGACGAACTT
TTACCAGCGGGCGCTATTTGTTTTTACCTAGTGTTAGAGATGGAACACCTTGGCCTGAAAATGTTGTGGCCTCTTGATTCGAGTACTCGCGAGCTCGAAT
CTTGCTGTAAACTGCTGAGCAACTGTATCTGTTTTGTTGTATGACTCTTGTGTAATCTAGGTTTCCTCACTTGATCAATCTATGCACATTTGCATGTTAG
CAGGGTGTTTTTCTGTGTCCGAATCGGATACATCTAGATCAC
page-top