Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig1315
Contig Information
Length 690 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc10a16    whgc15l11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0671200 [Oryza sativa (japonica cultivar-group)] >gi|32488409|emb|CAE02834.1| OSJNBa0043A12.39 [Oryza sativa (japonica cultivar-group)] >gi|90265248|emb|CAH67701.1| H0624F09.9 [Oryza sativa (indica cultivar-group)] >gi|113565789|dbj|BAF16132.1| Os04g0671200 [Oryza sativa (japonica cultivar-group)] >gi|125550177|gb|EAY95999.1| hypothetical protein OsI_17870 [Oryza sativa Indica Group] >gi|125592017|gb|EAZ32367.1| hypothetical protein OsJ_015850 [Oryza sativa (japonica cultivar-group)]
Score 343
Evalue 1.26689e-30
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig1315
ATTCTGCCTTCTCCAGCCACCGCCCGCCGGAAGAAAGAAAGCATCTTTGCTTCTCGCCGCCGCCGGTGAGGGAGGGAGGAAGGAAGGAGGCAGGGGATCC
CATTGGGTGTTGCCGGTTTGGAGCCAGGGTGATGAGCTGCCTCACGTTCCGCCGCTCCGCCGCCGACGCAAGCCGCCTCCAGGACGGCCTCCTCGTCTTC
ATGTTCTTCATCTCGATTCCCATACGTAGTCTGAATAATAGTCGTACTAGTAGTAATTCTAGTATTACTAGTAGTAATCTCTTGTAAACGCACGCCGCTC
GTGCTCGCGGTTGCGTTCGCGCGGACGGAGGGGCCTTCTTCTGCTGCTGCTCCGTCTGAATCTTCGTCTTCTTCTTCTCGTCGGGCGACGGTCGCGCCGG
CGGCCATGGATCCCAACAGCTTCAAAACCGGAGGCCTTCTGCTTCCAACCATTGAGAGGCGGTGCGCTTCGCCTCCATCTGTGATCGTGATCGGCGGCGG
AATCTCAGGGATTGCCGCGGCTCGTGTCCTCTCCAATTCCTCTTTTGAGGTGACTGTCCTTGAGTCGAGAGATCGAATCGGCGGCCGTGTTCACACGGAT
TACTCCTTTGGATGCCCCATTGACATGGGAGCCTCATGGTTGCACGGTGTCAGTAATGANAATTCTTTANCACCACTGATAAGCCATCTT
page-top