Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig1303
Contig Information
Length 169 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhgc10f20    rwhgc16n09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0549900 [Oryza sativa (japonica cultivar-group)] >gi|113611472|dbj|BAF21850.1| Os07g0549900 [Oryza sativa (japonica cultivar-group)] (no hit)
Score 203
Evalue 8.5965e-15
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig1303
TCTCACTCTTCCTGTCAGCAAGACGCCTTAAGTAGTCATCCTTGCTTGGCGGGGCAGGGGAGCTCGCCGGAGACGTTGTAGGCAGCGGACGGCGTCCGCG
GAGTCGGGGCAGGTGCCGGAGGAGAAATGGGAGATGCCGGCCTCGTGCCGAATTCGGCACGAGGANAGA
page-top