Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig1277
Contig Information
Length 1081 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc10f07    rwhgc10f07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein BCAH187_A0933 [Bacillus cereus AH187] >gi|217065732|gb|ACJ79982.1| conserved hypothetical protein [Bacillus cereus AH187]
Score 116
Evalue 0.000579169
Total Hit Count 88
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig1277
TCGGCGGCGGCGGCGAAAGGCGAACGAGCGAGGAACCCTAACCCTAACCCTAACCAGTTCCGATCCGCAAGGCCTGCGTCGATGGCGGCTTCCCTCCGCG
CGGCGGCGACGAGGATGCTGCGCCCGGCGGTGCTTCCAGGGGAGGGGCGTCGCCTGCTCGTCCACACCCAGCAGCTTTCCAAATCCACCCGCGCCTACGA
GGAAGGAAACCATGCCTTGAATGAATACCGTGCGTCGCTTATCCAGCAGAGGAAGGAGCAGCTGTACGTTCTCATTGCCGGCGCCGAGGCCAATTCCCGC
ACCTTCTTGCTGAACAAAAGTCTGCTCAAGGATCTCTCTACACAAGTCAAGCCTAGACCAGAGGACCCTCAATGGCGCAAGATATGTAGAACCAAGAAGG
TGACCGACTTCACTAGGTCGGCGGGTATTCTTGTTATTTCTGGGCTCACTTATTATGCCTTGATTTCCCGTCCTGAAATCGTAAGGTATGGTGACTATCT
TGTTACTGCTGAGAGTGTGCCCATGATACAAGAGAGGCTGGAGAGGCAAGTAATACAAGAGAGACTGCGGAGAGTTGCTACTGCTGAGGGAGTGAACAAG
CAAGATGGATATCAGCCTGTTGGTACTGCCGAGGGAGTGGACAAGCAAGATGGATATCAGCCTGTTGCTACAGCTGAGGGAGTGAACAAGCAAGATGGAT
ATCAGCCTGTTGCTAGTGCTGAGGGAGTGGACAAGCAAGATGGATATCAGCCTGTTGCTACTGCTGAGGGAGTGAACAAGCAAGATGGATATCAGCCTGT
TGCTAAAGCAAGTTGAATGGAGACGAAATGTATCTCTTGTTTGATGGAGAAGCAAGACGATATCAGTTCCATTACAGCACTATGTTATGTATGTCTCTTG
AAATATATATCCATCTATGATCTGCCACCTAGAACTTAGTAGTAGTATAACTGGATGATATGTGATTGCATTGTAGGATATGTGTGATGTTGCTGGCATG
CTATGTTACCCTTTGAGTCTAAAACTTGAGCAGTATTATAACTGGACGATCTGTGATGGCGTGTAAGATATATGGAATGCT
page-top