Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig1182
Contig Information
Length 1082 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc10a19    rwhgc10a19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_17876 [Oryza sativa Indica Group]
Score 273
Evalue 5.52503e-27
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig1182
AAGCCATGATTCTGTCGCACCAAGCAGTGTGCCTGAAACATCTACTTCTTCTGGTGCCATATGCCTAGCTTCCCCAAGTGTGAAACCCAAAAGTAGGGAT
TCTCCTATACGAATAATGTCACCTGAAAGCTCTGCAAATCATGGTGCCAAAAATCAGGATCCTTCTGCAGCTAGAATGGCACCTACACTTCATAACGTCC
TTCTGAGGACAGCTTCTGGAAAATCTGCATCTCATGGTTATGCTTCTCCAGCACCAAGTAATGCCTCAAAAGGCCGTGGGATTAGTGCTCCAGGACTCAG
TCTGAAGGGCTCTGAATGTCCTGGGCCAGTTTTGGCACTGGGAAGCACCAAATTCAGAGGGATGAAAAGTCCCAGCTCTGTGCCAAGAATGACACCTGAA
GGCCCCGGAATTTCTTTCACTGAGTATTGCGCCACAAAGCCAAGCAATTTATCCAACTAAGTGCCATGGTGGTGATTCAATTTCTTCTGTCGCAGCTCCA
GCTCATGTGCCAGGACATGTGAACTCTTCAGCTTTGAGCGCTGAAGGCTGCGATTCTCTAGCACTGAGTATCGCGCCAAACTGCCATGATCCTCCAGCAT
CAAGCAACAACGAGCCAGCGCTCCATGGGGCTCCAACAACACATACAGCATCTGAAGGCGAGCACTCTCAGGCGCCGAGTGCAGCCACCATGGGTTATAC
TGCTCCTGCACCGACAACCGGGGAGGCAGTACAATTTGGATCCTGCAATAAGCCATCAGCGCCCGTCCCTGAGCCCGGCAGCAACGTCGCTCAGGCGGCT
GACATCCTCGTCGCCCTGTCAACTCCGCGAGAGAAGGGCAAGTAGTAGCAGAGGGGACAGCCAGCCGAGATTGCACCGCGGATGACCCCTTTGGTCCCCG
TTTGGGATCTCTGTTGCTGTACATGTAAATGTTTACCCGTTTCATGTGCTGGATGGTGGCTTGGCTTGCCGTTGTACAGGCGGGGGGAACTTGTGCTGTT
AGCTCAGGTGTAAACAAACCAGTGGGATGTGCTGTTAGTTTGGGTTTATCTGTAGGGATACATACCAGTCACCCTGTCGACT
page-top