Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig1036
Contig Information
Length 710 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc10a22    rwhgc10a22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit conserved hypothetical protein [Ixodes scapularis]
Score 96
Evalue 0.0579674
Total Hit Count 176
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig1036
CACCAGTCGGCCATTCCGCGCAAGCCGGCGGCAGCCTCTTCGTGCGTCCACACTGGTGGCGCCTCCCTCGATCCCTCCCCCGGCAGTCCGTGTCTGCCAA
GCCGGCCGAACTACTTCCCTCACTTGGCCGTCCATGTCTGCCAAGCCGACCGGACAACTGCCAAGAACCCATATCGGAAGCGGCGGCGCTCCTCCTGTAG
ACACCACTGCGGCTGCCTTGCCACGACCCCAACCACCGCATGCCTCCAAAGACCGTGCAGAGGCATCATTCTGATAAACACATGGCAGCTAAGTTGGGGA
TTTTCCCCATTGCCGTTGTTTTTCATTCAATTCATATAATCCCTGTATTCCTCTCCCCTGGAGCATCCAGATCCCTTTATTTATTTTTATTTGGGATAGA
CTCACGCACCTTCCTCTCTTTGGCAGCAGGTGGCATGCTGCTGGCAATCCGGAATTGTTTATATTTCTTATATCCAACGAGGTACGCGGTCCAGTCCACA
CGAAACTGCACTGCCGACAACCTTCTCTACTCTTGAATCATGATCTCACATACGAATCATTGGCAAAGATTTTCTCTACTCTTGATCGTGGCTAATCTTT
ATCATCACAAAGCTTTGGTCACTTTCAGGGTTGCTGCTTGAAATTCTCATGCTTGCAATTTGTTCTAAATTCCAAATGCATAGTTCACCAATCATCCCTT
GGGTTATATT
page-top