Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig934
Contig Information
Length 1099 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc4m16    rwhgc4m16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Unknown protein DS12 from 2D-PAGE of leaf, chloroplastic; Flags: Precursor >gi|187663980|sp|Q0J709|UP12_ORYSJ RecName: Full=Unknown protein DS12 from 2D-PAGE of leaf, chloroplastic; Flags: Precursor
Score 1001
Evalue 1.41507e-106
Total Hit Count 195
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig934
ATCAGCGCCCTCTCCTTTGTAGCACCATCTCCCCTCCCCCACCCCACCCCCGGGTTTATTTGATAAGATTTGATCCCAATCCTCGCACGTTTCTTGGCCG
AGTGGGGGAGAAGATTCCAGAAATGGCCGTCGCCGTAGCCGCCGGGACCCTCCGTACCTGTTCCGGCGTATTTCCGGCGGCGTCCGGGAACCATCCACTT
GCCGGGTGGCGGCCACTTGCACCGGCAGCGCCCGCTAAGCTGAGATTATTGTCTCCAGCTTTGAGGGTTCCTAGAGCTGCTTCGCCTGCAGCTGTTGAGA
ATGGGAGCTCTAGCAACAGTAATACAGTCCCTACACCAAAAGTTATAATAGATCAAGACTCAGATCCGGATGCAACTATTGTGGAAGTAACCTTGGGTGA
CCGTCTTGGAGATCTTCTTGATACTATGAGTGCCTTGAGGAATTTAGGGCTAAATGTTGTGAAAGCTAGTGTCTGCCTCGATTCTTCTGGCAAGCACAAT
AAGTTCTCTATAACAAAGTCGTCAACTGGTCGCAAAATTGATGACCCAGAGTTGTTAGAAGCAGTAAGACTGACAATTATTAACAACATGCTTGAGTATC
ATCCTGAAGCTAGCAGTCAATTGGCCATGGGTGCAACTTTTGGGCTAGAGCCCCCTACGGAAGTGGTTGATGTGGACATAGCAACTCACATAGAGATCTA
TGACGATGGTCCTGAAAGAAGTTTACTTGTTGTGGAATCAGCTGACCGTCCAGGGTTGTTGGTTGATCTAGTTAAGATCATTGCTGACATCAATATCACT
GTCCAATCTGGAGAATTTGACACTGAGGGGCTACTGGCCAAGGCAAAATTCCATGTCAGTTACCGGGGCAGGCCATTAATCAAGGCTTTGCAACAGGTTC
TCGCGAATAGCTTGCGTTATTTCTTGAGGAGGCCGACAACAGAGGATGCCAGTTTCTAAGAAGATGATTACAAACCCACGCCTTATCATAGCTCATGAGA
CATGATATTTGTATGAAGTTTGCACTATCATCCAAATTATTCCTGAAATATGCATAATTCCCCAAAAAGGGAGGTACACGATATATCATGTACTCATAG
page-top