Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig929
Contig Information
Length 840 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc10e11    rwhgc10e11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit PREDICTED: similar to Inhibin beta A chain precursor (Activin beta-A chain) (Erythroid differentiation protein) (EDF) [Canis familiaris]
Score 80
Evalue 5.72217
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig929
CATGATGTGTGCTGTATACATATTAAAACCAAAATTGGAGTAGTTTCAGTCGTGCATATTAGAACTGAATTATGCTCTGTTTTCCTGTAGTTGTATGCTC
TTATTGCTGAATTGTTTAGAGGGTTGTTAAACTAAACTCGTCAAGTCGGTTTGCTATGATGTACTGTATATTACTGTACTTTAGACGTCTTGTAGAATTT
GGGCCTGAGCACTCTGGAATTTGGTTGCTGTTTGAGATTAATCTTTCCGAGACATTAGAGTGGGTTCAAGGATGGATCTGCCCATTCATTGTGCAGAGAA
CTTCTAATTTACCACTTCTCTACTAGTACATTAGTTATCATGAACCTACATGCTCCCTTCTCTGCAAAGTAAAGAGTAAAGAGGTTCCTTAACTTCACAG
TCAAGTTATGACAGCAGTTTGATATTCCTTTTGCTACCACATGTCCTTTAGTCTTTATCTCTCTGATGCTGCTTTCCTTCATCATGCAGGCACGCCCCGA
TGCTCCCTCCCCTCGCTCTGGGCACCCGATGCCAGGCAGGCTGTGGATGCCCCGAACCTCAAGGCTGGCCGTGCTACTCCAGCTGCTCCTGCCTCGGTCG
TGCTCAACTTTGCTCCTGGTCAGTTGCCGCAGGATCTAATGTTGTTTAGGCTGTTGTTGCTGTGACGGAAGATCAGAAGAGGCATGGAGATGCGCAACAC
AGTTTTAGTTGATGTTGCACCATGTTTTGGTGCTTGTGTATCTGTTTTTGCTTGTAAGCACTTGTATGTGCTTGTGTATCTGTTTTTGCTTGTATCTGCT
AAGTTTAGTTGATGTTGGGCATGCGAACATGTATGTGATG
page-top