Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig836
Contig Information
Length 710 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc10a23    rwhgc10a23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cp protein [Zea mays]
Score 842
Evalue 1.81777e-88
Total Hit Count 194
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig836
TCCAGACCGAATCCGGCCGATTCGAGGCGGACTGGGGGTTCGGGTTCGGGGCGGGGAAGAGGGGAGGAGGGGGAGATGGACCAGGTGCTGAACAAGGTGG
GGAGCTACTGGTTCAGCAAGAGGGCCAGCAAGGAGATCGACTCCATCGGCGACGACCTCAACTCGGTCTCTTCCAGTATTGGCGGGGGAGCTAAATGGAT
GGTGAACAAGATCAAAGGCAAGCTGCAGAAAGCATTACCAGATCTTCTCAAAGAATATGACATGCCAGCAGGCCTCTTCCCACGGGACACAACTAATTAC
GAGTTCAATGAAGAGACAAAGAAGCTGACAGTGTACATCCCGTCAGCTTGTGACGTCGGGTACAAGGACTCATCGGTGGTGCGGTTCTTCACCTGTGTGA
CCGGCTACCTCGAGAAGGGAAAGCTTTCTGACATCGAGGGCATGAAGACCAAGGTGCTTGTATGGACCAAGGTGACCTCCATCAAGACCGAGGGCTCAAA
GGTCCATTTCACTGCCGGCATGAAGAAGACCCGCAGCCGCGATGCGTATGAGGTTGTCAGAGATGGCATCATCATAGACAAGTTCTAGAGCATACCTGTA
CCTGGGCTGGCAGGTGCAATGTAATTACTTAGATATGCTACATTGGAATCTGTTGTGCTATCGGATCGGCCTATTAACCAACTGTGTTGCTCAAATCTCC
NAAAAAAAAA
page-top