Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig829
Contig Information
Length 1200 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc10a24    rwhgc10a24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_001621 [Oryza sativa (japonica cultivar-group)]
Score 211
Evalue 6.49963e-15
Total Hit Count 48
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig829
CTGGGAACAGTATGTCAAGTCTTGAGAATTGGGATGGATTCATAGATGTGGATTGCCCACGGGCGAGGATGTGCGCCGCAATAGCTCTAAGATGCACGGA
CGCTGAGGAATATAATAGGCCTACCTTACATGAAATAATTTGTGAACTGAACAAGGTGGAGAGCATGGTTTCACAGTTTCCCATAAACCAGCTGCTGCAC
CCTGTCGGCACTAGTTTTGCAGTACTGGTAGCTTATGCATTGTTGCTTATGATCAGTACAAACTACATCCAAATAGCTGTGATCCCGGCTATCATACTCG
TTTTCATCGGTGTTTTGTGGGGCAATTTCTGGGTCAAGGGAAGACTTCAGCATAGAAACAACAATGGAACTGCTGCTAACCAGGGGAGTGGCAGCGGGCA
AGCTTGGAGGATGCTGCTACCCACGGTACTACTGTCGTATTGTTTGCAGCTAATCCAGCTTGCCTGTGCACAAGTGACCAATGGACAACAAAGTGACAAT
TTCCTCTTCTCTCACTCCCTCCTCTTCCTGAGTTCCGCGCTTGGTGCACTGGCCGTGATGATTGCCGCGCTGCCCATCAGAGCCAATCAATGTGTGGCGC
AGGGACAGCAGCTTATTCACAGGATCTTCATTGTGGTTTTTATGATAGCAGTGCACATGATGGCTACAGAATGGATGATGGTGGAGGTCATGCCACTGGT
TTGCATGCCGGAGTTTATTGCATCACTTGTGTGGCTCACCACTGGTAATTTTGATCACGCCAGATGTATGGTGCTCATCGACAAGGTAACATCACGCAGA
TCAACAGTCACCTTTCTCACTGCAGCAGTGGCTCTGTTAGCGTTCATGTTTGCATTTGAGAACGAGATGGTACTTGCTAGTTACTGGTACAGAGGAATCA
TGTACTCCTGTACCTTGTCAGGGCTTCTATCCTGCTTGTGCGTGTGGATGATCCTTCAGTGGCGGCCGGATATCTCTGCTAATGTGCCCCTTGACTGGCC
GAGCGGTAGTGCGATCATTTCCATAAGGATCCTTGAGTTCTCGGCACTGATTTGCTTTGCTATGTCAGCTGTGCTTCTCTTCATTGGGTTCCTCTTGAAT
TACTCAATTCTGTAGATCTAAGTTTGCTATGTAAGCATGCATGGCTACCTTGTATGGCGGCCTCGGGACAAAGATTGACCATAACTGTAGTGTTTTGCAA
page-top