Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig822
Contig Information
Length 848 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc10b03    rwhgc10b03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_024118 [Oryza sativa (japonica cultivar-group)]
Score 152
Evalue 2.61527e-08
Total Hit Count 422
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig822
CGAATCTTAGATTTTTCGCCTCTCTCGCGACGGGAAGGCTGTCCTCGCGCCGGATCTGGGGGCCGGTCATAGGTCCGGCAAGGCACCAGCTCTCCAAGAA
CATCCCTGCTGGTGTGCGCGGATTCGGCTCCTTTGACAGGTTGCCCATTGGCCAAGTCAAAGACTGGTCACTTGGCACTGTTATGTCCCTGGGTTCCTTG
CCAGTCTTTGCTGGAGGCATATGGTATCTCAAAACTAATCCAGAGGAGCAGGGTGCTCAGAAGCCCACCGTTGAGGACCCGGAGGAGAAAGCCATGAAGA
AGAGATTCGAGGAGTGGATGGTTGTGCACAAGCGCAGATACAAGAACGAGGAGGAGAAGGCACGGCGCTACGAGCTGTTCAAGGGGTGTGTCAAGCGGGT
GAACGAGCTCAACGCCGCGTCACGGCCGGGTGAAGCCCGGTACAAACCATACCGATATGCTGACTTTACCAAGGAAGAGAGGAGCAAAATACACGGAATC
GTGGTCGAACCATCTATGTTCGACGAGTGGAACGAGGAGAAGAGGCGCAAAACACAAGGGGGCCATGACGGCGGCGCCGACGGGGACGACTGGGAAGAAG
AGATGCGCCTGATACAAAGGTGTCTTCGCACTGCGGCCCTTAATGGCAAGGCACAATGCAAAGCACAGCAGTCGTCCTAAGTGGTGAATTAGTATCTATG
TTAGCTTCCATCGGTGTGTTATATCGATATATATAAATGCCCCTGTGATTGGTGAGTTTATGCATGCCAATGTCTGTTGCTACTTATGCCTGGAGCCTTG
CAGTGTTGAACTTTAATTAGAACTTCCCCTGTACCGCTGTACGTACTC
page-top