Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig630
Contig Information
Length 602 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc17d06    rwhgc17d06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal Pr 117 [Triticum aestivum]
Score 655
Evalue 6.10435e-67
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig630
ACAAGTTCCGGATGTCGCTGGGTCTGCCGGTGGCAGCCACTGTCATCTGTGCTGACAACACTGGTGCCAAGAACCTGTACATCATCTCCGTGAAGGGAAT
CAAGGGGCGCCTCAACAGGCTTCCTTCTGCCTGCGTTGGTGACATGGTTATGGCCACTGTCAAGAAGGGAAAGCCTGACCTCAGGAAGAAGGTCATGCCG
GCTGTCATCGTCAGGCAGCGCAAGCCGTGGCGCCGAAAGGACGGTGTCTTCATGTACTTTGAAGACAATGCTGGAGTCATTGTGAACCCAAAGGGAGAGA
TGAAAGGTTCTGCCATCACTGGACCGATCGGGAAGGAGTGCGCCGACCTGTGGCCCAGGATTGCCAGCGCCGCGAATGCCATCGTCTGATCTGATCGCCG
GAGCAGCTAGATGATCAAAGCTTTTGATAGCATGTCCCTCTTTTCTTCTAGTTTACTTGTGGCCCTTGAGGATGAGTTTCCTGGATTATGTAATGCTGCT
GGATTATTGTCTGTTAGGTTTAAGATTTTGCACTGTGGTTTGGCTGCTAAGATTTGTTCAGTTTGAACCTGAAAGAGCTTTTGATCGGATTTAAAAAAAA
AA
page-top