Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig610
Contig Information
Length 664 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc10d22    rwhgc10d22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit predicted protein [Phaeodactylum tricornutum CCAP 1055/1] >gi|217411179|gb|EEC51107.1| predicted protein [Phaeodactylum tricornutum CCAP 1055/1]
Score 81
Evalue 2.73916
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig610
CCTCGTGCCGCGCTAAACTAACTATACGAGAAACCAGGGGAACTAGCCCTAGCCGCCGCCACGTGATCGAATCCTTCTCACCTTCGTATGGAGGATTTGG
TTGCCTGCTGCGGGCGGCTGTGTTGGCGATCCACAGCGCCGATCTTCAACGGCAGCACGGCCTGGATAGGTCAACGGAGAAGAGGGAGTCGGTGCATGGT
TCTGCGCGACGGCGAGTTCGGCATCATACCCAAACCTATTGTGCAGCGGCATGGGTGATTTCCTTTTTTCAGATTTTCTTTAGAGAATCATCGAGTGGAG
GGCTTGTGGAGCCGTCGATCGGCGTTTATGGTCTTCGGAGTTTGTATAGGCTCTTATCAACGTTTTCTTCTCCGGGGCAGCGATTTGCTTCGCAGATCAC
GGATGTTGGTGTCTCCTGATCTGCATCGACGAGTTCCCGGTCGCTCCTTCTACAAGCTCCTGGGTCTAAAAAAGTTTGCTCTGCCAAGGCGAGGGCTAGA
GGCGGCATCGAGTTATGCTCACAATGCGCCGCCGATGGATACGGGAGGAAGAAGACTTCGGCGCCCCCAAGAATTTGAATGTAATTTTATTTTTCTGTAT
GGGTGTATTTGTAAGACCTTTTGATACTTAATATATGGCCTTCTGCAATTTCACAAAAAAAAAA
page-top