Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig580
Contig Information
Length 1370 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc10d18    rwhgc10d18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_024418 [Oryza sativa (japonica cultivar-group)]
Score 366
Evalue 8.34904e-33
Total Hit Count 15
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig580
CGCGCCCGCGCGCCACCACCCGCTCCTCCTCGCCTTCCAGATCGCGCCGCCACCTCCCTCCCCATCCCCTCCATGATCTCTCCCTCGGTGAGCCACCGGC
GAGCCCCTCTGCTGCCCGCGCATGCACAGCCTCGCCTCCTCCTGCTCTCCATCGACCCCCTCCGCGTGCTCGCCATCATCGCCTCCCTCCGCCGCATCGA
CCCCAAGGTGCTGGCGCAGGCGACCAGGAAGCTGTTCCAGGGTGAGCCGATGAAGAGGCGGAAGGGAATTTGGATGTAGATCAACAACTACGAGGAGGGG
GAGGAGAGCGAGAGGGGCAGCGTGGTGGCCAGCAAGGGGAGCACCATCACGGGAGCCGCGTCCTCCCGGTCCACGGCCACGTCGGGGAGATGCCGCCGAC
CTTCGCTGGCGAGCGGCGGCTGTGAGAGTCTGGTGCGGAGGGCGGACTCGATCATGAAGTCGCTCTCGTGGTCCAAGGCGGCCCCAGTCACGGAGACGGC
CATCCGCGCCGCCATTGGCGACAACGCTGTAACTAGCAAGGCTGTGCGCTGGTTGCTGAAGCAGAAGAGAGGGTTGCGTCGTGCGGGCACTGGTGGCCGC
CCGGATCCGTATGTGTACATGGTACGTGAAATCTGTGCCACACAGTTTGCGTTTGGATGATGATTTGATTTCTGAAAGTAGCTAAATGTAAGGTATGACT
GAATCAGTATAACTGAGAGTCAGTGTCCAACTTCTAGATGGAGTTAGGGAGTTGTTACTTATTGGAGTAGTAATTTCCAGTTATTCAGTACAGAGTAAGT
AGAATCTAAAAGCAATTGTTAAATCTTATTAATTTATCCTAGTTCCACTCACAACCTCAGTTCTATAATTCTGGAAGCCAGTTGAATCTTGAACACTGCA
CATTTCGAAAAAATGCTTCCAAACCACATAATTTCATTCCTTGATACAGAAAGTACAGCAAGTTCTGATATACATCAATCCTGCTTTCCTCGTACCAATA
AAGCATGTCCATAACATTGGATTATAGCAAAAAAATTGCTAAAAGAACAAACGCCCAGTCAAAGCTTTGAATGATTAGGTACTGTAAATTGGATCTCCTG
CATAACTGCACTTTGCCATTTGCTTCAGGCACTTCTTGTTCTGCCAATCCACGAGCAGGGAGCGGAAGGCGCAGCCAGCGACCAGCGAGCACATGGGTGG
CACAAGTGGCGACGGAGAGCGGCTGGAGACTGCCAGTGATGAGCGGCGATGGCAACCTTGAGACCAGCAAGTAGGCGACGGCGACCTCATTGTGAAGTGG
CTGAATCGACTTGAGGCGGTTTCTTTGAAATTCTTGGAAATGCTTTGGTAGTTTCTTTCGGCGAGAAACT
page-top