Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig1560
Contig Information
Length 517 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 10 Clones [Download: CSV  ,  FASTA ]
whfl10h02    whfl10j23    whfl11c18    whfl5g16    whfl18i23    whfl2j12    whfl17p17    whfl9n19    whfl34p04    whfl36p04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0566600 [Oryza sativa (japonica cultivar-group)] >gi|21741799|emb|CAD41286.1| OSJNBa0005N02.4 [Oryza sativa (japonica cultivar-group)] >gi|113565153|dbj|BAF15496.1| Os04g0566600 [Oryza sativa (japonica cultivar-group)] >gi|125591314|gb|EAZ31664.1| hypothetical protein OsJ_015147 [Oryza sativa (japonica cultivar-group)] >gi|215678820|dbj|BAG95257.1| unnamed protein product [Oryza sativa Japonica Group]
Score 256
Evalue 2.30757e-26
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig1560
acGGGGGAGCACGGCACAGGCAAGAAACCAAGGGGTAGAGCCGTAGAGCGGCGCCAAGGGCAACCAAGCTCCCACCACCACCAGTATAAAAACCTACTCC
GGCCTTCTTGTCTTTTGCCATTCCAAGGTAGAAGAACAAGGGCAGCTTCGAGAGGGAGGCGAGACAGGAGAAGGAGAAGGAGGAGGAGATGGGGAGCAGC
GCCAAGAAGCAGGAAGCCGTGAGGCGGTACGTCAGATCCCGGGCTCCCAGGATGCAATGGACGGCCGAGCTCCACCGCAGCTTCCTGCAGGCCATAGAGT
GCCTCGGTGGAGAACACAATGCCACTCCTAAGCTGGTTCTCAAGGTCATGGGTGTGAAGGAGCTTACCATATCCCATGTCAAGAGCCATCTGCAGATGTA
CAGAGGCCCGAGCACTCGCAAGGCCAAGAGAGAGGCGCAACCAGGGCTTGCAAAGGAGGCACTCATGTGCCGCTGATGAGCAAGGAGGAGCCCCCTTCAT
GTGCCCACCTCTgaaaa
page-top