Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig463
Contig Information
Length 594 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc10d11    rwhgc10d11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 432
Evalue 4.22167e-41
Total Hit Count 86
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig463
CTTGGAATTGGTGGAGCCTGCTGTAAGCATAAAAACTTTGAGGGCTCGTATGATTGGTCTTGATAAGAATGACCTTGACAAAGCTTTCATACAGCTTACG
CTTGAGTTCGTCACTAAGCAGAAGTTTGAAGCCTATAATTCAAAAGGAGAGGTTGTGTCAGGGGACAAGTCAAAGGAGGTACTGGTGAAAGACATATGGG
TGTTTGAAAGATCCCTTTTCCACCCTGGAGCATACTGGCGCGTGTGTGGGCGAATCACATTGTGATAATCTCTTGGTTCCTTCCTGAATGAGCTGAAGGA
TGGCTTTTGTTATGCACAGCAGTTTGAATAAATATTTTGCCCTGCCGCCCTTTTTTGCCTGTCTAACTGATTGTCTAACGAAGATCTACAGACATGCTTA
TGTAGACAGGTTTTTCTTTTGTTCCTCGGGGAATTGTCAGCTGAAGATACAAGTCTTGTCCCACATTAGTTAGCGAAGCAACTTGGGCATACTGCATTTG
GTGGTTTTATTTACTGTTACCAGATTTGTCTCCATTGTGGTAATTTTGATAGAACATTGCCAATAACTTCAGAGAACATACAGTAAAAAAAAAA
page-top