Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig298
Contig Information
Length 1130 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc14m03    rwhgc14m03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit retinol dehydrogenase 12 [Zea mays]
Score 1257
Evalue 3.03636e-136
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig298
GTGGTGGCTGGCGGCGGCAGCAACGGCGATGGGGATCTGGGGCTGGCCGTGGGGGCGGCGTGGGCTCTCGGGCTTCGGATCCGCGTCCACCGCTGAGGAC
ATCGCCGCCGGCATCGACGCCAGCCATCTCACAGCCATCGTCACTGGAGCAACAAATGGCATTGGCAAGGAGACGGCCAGAGTTCTTGCACTGAGGGGAG
CAAACGTGATCATACCAGCAAGGACGCTCGAGAGTGGCCTGAAGGTGAAAGAGAGCCTCGCTGAAGAGGTCCCGAGCTCCAAGCTACATGTCATGGAGAT
GGATCTGAGCTCCCTCGACTCTGTGCGCACCTTCGCGGGCTCCTTCAACTCCTCCCATAAGCATCTGAACGTCCTCATAAACAATGCAGGAATAATGGCC
TGCCCTTTCCAGCTATCCAAAGATGGCATTGAGCTACAATTCGCAACGAATCATCTCGGCCATTTCTTGCTGACAAATCTTCTACTTGACAAGATGAAAT
CAACTGCCAAGGAGACCGGTGTGCAGGGTAGGATCGTAAACCTAGCTTCAACAGCTCATAGAAGGAGTGATGGCAAAGGCTTTGATCTGAACAAGCTGAA
CAACGAGTCCAAGTACAATGCATTTAGTGCATACTCACACTCCAAATTAGCAAATATTCTCCATGCAAATGAGCTATCCAGGCGTTTTCAGGAAGAAGGA
TGTGATCTGACTGCAAATTCGCTGCACCCTGGAATCATCGGAACCAACATCGTTCGCTACATCACGACAAACAGTGTGCTGGCCTCGATTTTCTCGCTGG
TCAAGCCTTTTGTGAAGGATATACCCCAGGGAGCTGCAACTACCTGTTATGTGGCATTGCATCCTGATACCAGGGGTGTGTCCGGCAAATACTTCGCTGG
TTGCAACGAGGCGACGCCGACCTCCGTTGCAAGAGATGCAGAGCTGGCCAAGAGGCTGTGGGCGTTTAGTGAAGAACTTGTAGAAAATAGATCAAAGTGA
TGCGATGCGGTGTGCTGTGATTGTGTGCAGCGGCGACGCATAACTCCGCCACTGATTGTTTGTATATATGCATGTACTGATCGAAGAGGGTATGTCTACC
TACCTAGCTGTAAACTGCCAAAAAAAAATC
page-top