Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig99
Contig Information
Length 666 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc12c04    rwhgc12c04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit yersiniabactin polyketide/non-ribosomal peptide synthetase [Pseudomonas syringae pv. tomato str. DC3000] >gi|28853035|gb|AAO56104.1| yersiniabactin polyketide/non-ribosomal peptide synthetase [Pseudomonas syringae pv. tomato str. DC3000]
Score 78
Evalue 6.17002
Total Hit Count 4
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig99
TTTTTTCTCCCCAACCAGCGAGGAAGAGGAAGAGGAAGCGGATCGAGTCGGCGAGAGCGAGGGCGAGGACGATGGCGGCGCTCCGGCTAGCGGTGAGGAG
ATTTTGCGACCGTGCGCTCGGGAGATCAGCGGGCATTTACGAGCTCAAGGCTGCCAAGGAATTCCCCGACATTGATCCTGGGCATCTCAAGGCTGCCAGG
AAATTCCCCAAACTTCGTGTCAAGGATGTTGATGCTACGGCTCCTGAATGTCTTCAAGATTCTCAGGCAGAGTCCAGTCGATGGTCATGTGCGCATGACA
CTCAAGACCTTGGCTGAGATTCAGGAAGAAGAATGAAGATGCGCTACTAGGAAGCAATATCGTCTCTTGCTCTAATATGAACTAGCTTTGCAGTATCGTA
GTATTTGAATCTTTCCTATGTTGTCGCTCTGTGTCTCGATCTTCAAAACTGCTGGACGGATGTGATGTTTTGCTATTTTCTTGCTTCACAAGGTTGAATC
ATCCTTTGATCTTGACATGCCCACCAGATTCGAGTGTAAGCTTTCGGGCTAGCGATAAGGGCGGCATGTACTTGGTATTCGTAAGATTTGCTGGATGCTT
GTACTCAGTTTCCTTAAATTATAAAATACTATATGGTAATGGAATGGATCATTTGGAAAAAAAAAA
page-top