Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig98
Contig Information
Length 1168 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc12c10    rwhgc12c10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0376500 [Oryza sativa (japonica cultivar-group)] >gi|38346118|emb|CAE04596.2| OSJNBb0006N15.13 [Oryza sativa (japonica cultivar-group)] >gi|113564153|dbj|BAF14496.1| Os04g0376500 [Oryza sativa (japonica cultivar-group)] >gi|125590097|gb|EAZ30447.1| hypothetical protein OsJ_013930 [Oryza sativa (japonica cultivar-group)] >gi|215737293|dbj|BAG96222.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218194711|gb|EEC77138.1| hypothetical protein OsI_15576 [Oryza sativa Indica Group]
Score 1615
Evalue 9.83748e-178
Total Hit Count 295
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig98
CCCCGCGCCGCCGACCACCGAGCAGCCATGGCGAATCCACTGGCGGCGGGAGGGAAGTCGTTCCTGCAGGCCATGTCGACGGTCACCGAAGAGGCGGCGG
TGCCGCTCCGCGTCGTCCAGATGGAGGGACTGGCTGTCCTGAAGATCATTAAGCGCTGTGAGGAGTTTGCGCCTGCTCTGGTTACAGGTCAACTGCTTGG
TTTGGATGTTGGTAGTGTTCTGGAAGTGACCAACTGTTTTCCTTTCCCTATAAGAGAGGACGACGAGGAAGCAGATGCAGATGGTGCGAACTATCAGCTT
GAGATGATGAGGTGCTTGAGGGAGGTTAATGTCGACAATAACACTGTTGGATGGTATCAGTCCTGCTTGCTTGGATCTTTTCAAACCGTTGAGCTGATTG
AAACATTTATGAACTATCAGGAGAACATCCGGAGATGCGTGTGTATTGTGTATGACCCATCTAGATCTAGTCAAGGAGTGCTAGCTCTTAAAGCCCTGAA
GCTCACAGACTCTTTTATGGATCTGTACCGCAACAATGGTTTAACTGGAGAGAAGCTAAGGGAAAAGAAATTGTCATGGGTTGATATTTTCGAGGAGATA
CCGATTAAAGTGTCCAACTCGGCGCTTGTCAGTGCCTTCATGAAGGAGCTGGAACCTGAGTCACCTGTTTCACAGTGTGACTTTGACCGTCTTAAATTGT
CGACTGCGCCCTTTATGGAAAGGAACCTAGAATTTATGATTGGGTGCATGGATGGTCTTTCATCAGAGCAAAACAAGTTCCAATATTACTATCGCAACCT
AGGAAGGCAACAGTCACAGCAACAGGCATGGCTTCAAAAGAGAAGGCAAGAGAACATGTCCAGAAAGGCTGCTGGCGAGGAGCCGTTGCCAGAAGAAGAT
CCATCCAACCCTATCTTCAAGCCGCTTCCTGAGCCATCCCGCTTAGAGGGTTATCTCGTAACCAATCAGATCTCGAGTTACTGCAACCATATCAATGGGG
TTGCTGGCCAGAGTTTCAACAGGCTATACTTGATGAAGGCGTTGCAGGAAGATTAGGTGCCGGGTGGCAGCTGCTGTGAGATTTTAACTTAACACTGTAC
CGCACCTCAATTTTGCAATGTACTCCATGTGCACCCGCACATTGCCTATTTTGTTTGCCCAAATCAGA
page-top