Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig97
Contig Information
Length 1064 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc13f12    rwhgc13f12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 1081
Evalue 7.12638e-116
Total Hit Count 176
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig97
GCCATCCACCCACGTCGACGACGAGCTCTCCCCTCTCGTCCCGTCTCCTCCCCCTCGCGACGCCACCGCCGCGTCGCCGGTCGCGGGCTCGCCGCCCCAG
GTAGGACGTAGCTAGTCACCCCGCCCGGCCCCGATGGCTGAGGAGCTGGTGCTCGACACGGCGATCCGGGACTGGGTCCTCATCCCGCTCTCCGTGGTCA
TGGTGCTCATCGGCGTGCTCCGCTACTTCGTCTCCAAGCTCATGCGCTCCCCGCCGTCGGCCTCCCCCTCCCCCGACCCCAAGACCGTCAAGGAGGGGCA
GGTCGTCATCAGGGCGAGGAACCTGAGGAACGGCGCGCAGTTCATCCCGGCCAAGGCCTTCAAGGCCCGCAAGCTTTATTACACCAACGGGGAAGCCGGA
TTGCTTCATGTTCCTAAAGAGGATGCCCAGAAGGCTCAGGCGGCTATGTTTTCGGACCCAAACATGGCCATGGATATGATGAAGAAGAATCTCTCCATGA
TAGTTCCACAGACACTTACATTTGCATGGGTGAACTTCTTCTTTTCCGGTTTTGTTGCAGCCAAAATCCCCTTTCCATTGACTCAACGATTCAGGGGAAT
GCTGCAAAATGGGATAGACCTGAGTACTGTTGATGTGAGCTATGTTAGCAGCCGTTCATGGTACTTCCTCAATTTATTTGGCTTGAGGGGTCTTTTCAGT
CTCATCCTTGGTGAAGAAAATGCTACTGATGATGCCCAAAAGATGATGGCGATGGGTGGTGGAATGGGCTTTAATCCAGCAATGAGCTTGAGCGCAGAGA
AAGACAGCCTCGACATCATCCAGCATGACTGGGCTTTACCGAAGATGGAGCGTCATGCCGAAGAGGTGTTGAGGAAACTACTGAAGAATTGACCTGAACA
AGCACGACTAGGCCCTGCAAGTTTTGTTTTTAGCTTGTTGACTCAGTTATACATCTGTAATTGTATTGTTTATTTACGAGCGCTACTCATTACGAAGCCG
TGAGATATCTTTTTCACTCATGTAGTCTGGCAACACTAGTAGAAAAGGATGTATTCCATATCAT
page-top