Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_GCPCDAM_all.Contig96
Contig Information
Length 487 bp
Tissue Anther at meiosis of DT4B CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whgc12c17    rwhgc12c17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit protein of unknown function DUF6 transmembrane [Geobacter lovleyi SZ] >gi|189419871|gb|ACD94269.1| protein of unknown function DUF6 transmembrane [Geobacter lovleyi SZ]
Score 77
Evalue 3.47495
Total Hit Count 8
Registered year 2003
Contig Sequence     [ Download ]
>Wh_GCPCDAM_all.Contig96
GGTTAATGAAGCAACGGCCAGCATACCCAACTGGGAATCGTACGCAACTGAGTGACCTTGTGCAATCTGATACTTGTCAAGCCGATTTGAATCGCAAAAA
AAAGCCGATTTTGTTCGCTCGATCACCGGCCAAGCTTGGATAAGTGGCTCATACGAATTTATCCAGGGCCCTGACTCCAAGCGTGTGTATTCTGGCCTTG
GATTGCCGAAATCCGGAAGCAAAACCAGTGCAAAAACAACATGATCTCCTTAGTTACAGTCACACATATAGGATGTCTTAGGTGAGAATTACAATGGAAA
TGAGTGTGAGGCGTGTTGAGCTCTTGTTCTTGATGCTCATTCCTGACTTGTGAGTTGTGACTTCATCCTGAGTCCTTTCCCCTTCAGAAAAGTTCACGGA
CACTGTATTTTAGGCAAGACAATGGAATCCTCTGTTTACTTGTTTTTTCNTTANNAAAAAAAAAAAAAAAAAANCCCAAAAAAAAAA
page-top